Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_RDr_all.Contig7
Contig Information
Length 801 bp
Tissue Root of dessiccated seed
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhrd15k14   
Homology (BLAST) Top Hit polyprotein [Oryza australiensis]
Score 532
Evalue 2.03197e-52
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_RDr_all.Contig7
ATTATTTAGGTCTAAAACTAATCCCGATGGTAGATGTACAGGTAGCGTGCCGACCGCGATCACATCGACTTTGGAACCATTTCCCACGCGCATCGTCACC
TCGTCCTTAGCCAATCTTCGCTTAATTCGTAGTCCCTGTTTCGAGTTGCAAATATTAGCAACAGAACCAGTATCAAATACCTAGGTGCTACTGCGAGCAT
TAGTAAGGTACACATCAATAACATGTATATCACATATACCTTTGTTCACTTTGCCATCCTTCTTATCCGCCAAATACTTGGGGCAGTTCCGCTTCCAGTG
TCCAGTCTGCTTGAAGTAGAAGCACTAAGTTTCAGGCTTATGTCCAGACTTAGGTTTCTTCTCTTGAGCAGCAACTTGCTTGCTGTTCTTTTTGAAGTTC
CCCTTCTTCTTCCCTTTGCCCTTTTTCTTGAAACTGGTGGTCTTGTTAACCATGAACACTTGATGCTCCTTCTTTATTTCTACCTCTGCGGCTTTTAGCA
TCGCGAAGAGCTCGGGAATAGTCTTGTTCATCCCTTGCATATTATAGTTCATCACGAAGCTCTTGTAGCTTGGTGGCAGTGATTGAAGAATTCTGTCAAT
GACACTATCATCAGGAAGATTAACTCCCAGTTGAATCAAGTGATTATTATACCCAGACATTTTGAGTATATGTTCACTGACAGAACTATTCTCCTCCATC
TTGCAGCTATAGAACTTATTGGAGACTTCATATCTCTCAATCCGGGCATTTGCTNGAAATATTAACTTCAACTCCTGGAACATCTCATATGCTGCATGAC
G
page-top