Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2159
Contig Information
Length 985 bp
Tissue Anther at meiosis
Clones 35 Clones [Download: CSV  ,  FASTA ]
whpc10a10    whpc10h08    whpc11d01    whpc12c08    whpc1e01    whpc2e24    whpc2o20    whpc3n18    whpc3n20    whpc4c03    whpc6k22    whpc7c18    whpc7h14    whpc13d01    whpc15n22    whpc18a12    whpc18k01    whpc19o01    rwhpc10a10    rwhpc10h08    rwhpc11d01    rwhpc12c08    rwhpc1e01    rwhpc2e24    rwhpc2o20    rwhpc3n18    rwhpc3n20    rwhpc4c03    rwhpc6k22    rwhpc7c18    rwhpc7h14    rwhpc15n22    rwhpc18a12    rwhpc18k01    rwhpc19o01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0489600 [Oryza sativa (japonica cultivar-group)] >gi|1703380|sp|P51823|ARF2_ORYSJ RecName: Full=ADP-ribosylation factor 2 >gi|1132483|dbj|BAA04607.1| ADP-ribosylation factor [Oryza sativa Japonica Group] >gi|13646976|dbj|BAB41081.1| ADP-ribosylation factor [Triticum aestivum] >gi|23304413|emb|CAD48129.2| ADP-ribosylation factor 1-like protein [Hordeum vulgare subsp. vulgare] >gi|50511366|gb|AAT77289.1| ADP-ribosylation factor [Oryza sativa (japonica cultivar-group)] >gi|113579443|dbj|BAF17806.1| Os05g0489600 [Oryza sativa (japonica cultivar-group)] >gi|125552797|gb|EAY98506.1| hypothetical protein OsI_20417 [Oryza sativa Indica Group] >gi|125594700|gb|EAZ34759.1| hypothetical protein OsJ_018242 [Oryza sativa (japonica cultivar-group)] >gi|215692842|dbj|BAG88186.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215695044|dbj|BAG90235.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767619|dbj|BAG99847.1| unnamed protein product [Oryza sativa Japonica Group]
Score 939
Evalue 1.85307e-99
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2159
CTCTCTCCTCCATTTCTCTCCTCCTCCTGCCACCGATCCCGAACCAGGGAGGAACCCGGCGCGAGGAGGGCAAAGGAAGAGAAGAGGAGATCACCGAGCC
CCAGCGCGCGCACAGGACAGCAGGCGCCGCGATCTCGCACAGGAGCGGAGATGGGGCTCACGTTCACGAAGCTGTTCAGCCGGCTCTTCGCCAAGAAGGA
GATGAGGATCCTCATGGTCGGTCTCGATGCGGCTGGTAAGACCACCATCCTCTACAAGCTCAAGCTCGGAGAGATCGTCACCACCATCCCCACAATCGGG
TTTAATGTCGAAACTGTAGAGTACAAGAACATTAGTTTCACCGTTTGGGATGTCGGGGGTCAGGACAAGATCAGGCCCCTGTGGAGGCACTACTTCCAGA
ACACCCAGGGTCTCATTTTTGTCGTGGACAGCAATGACAGAGAGCGTGTTGTTGAGGCAAGAGATGAGCTTCACCGGATGCTGAATGAGGATGAGCTGCG
TGATGCTGTGCTGCTGGTGTTTGCAAACAAGCAAGATCTTCCTAATGCCATGAACGCTGCTGAAATCACTGACAAGCTTGGCCTGCATTCTCTGCGCCAG
CGACACTGGTACATCCAGAGCACATGTGCTACCTCTGGAGAGGGGTTGTACGAGGGGCTTGACTGGCTGTCCAACAACATTGCCAACAAGGCTTGAAGCA
TCTCGGCAGGGGCTTCTATGGATCTGGATAAGCTGGATATTCGGACTAATACTGCCTTTACGTATTATAAACTATATAGTCTTGACAGATAATGTGGGTG
TTTTGGAAAGATAAAGCTCTCTGTCAAAGAGCTAGCTATCAGATTGTTTTCGTGGGTGTTAAATTGTCCGTGGCGCTGTTTGTTTGCCCATCATGGTTTT
ACTATGTCCGCTCTGTACTCTGTACTCGCCACTCCGACAGACTTGATACATTGTAGTATTGACTTGTCTTGGCATAAAAAAAAAA
page-top