Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2155
Contig Information
Length 867 bp
Tissue Anther at meiosis
Clones 29 Clones [Download: CSV  ,  FASTA ]
whpc10e22    whpc10f22    whpc10o12    whpc10p23    whpc10p24    whpc12b06    whpc12b17    whpc1n24    whpc2l14    whpc4b21    whpc6m13    whpc9p24    whpc13o04    whpc14a16    whpc18a02    rwhpc10e22    rwhpc10f22    rwhpc10o12    rwhpc10p23    rwhpc12b06    rwhpc12b17    rwhpc1n24    rwhpc2l14    rwhpc4b21    rwhpc6m13    rwhpc9p24    rwhpc14a16    rwhpc18a02    rwhpc18a13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 928
Evalue 2.80187e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2155
CCTCCTCCTAGCAAGCTATATACCTACATAGTACAGCCATGGCCCCCACCGTGATGGCCTCGTCGGCCACCTCCGTCGCTCCTTTCCAGGGGCTCAAGTC
CACCGCCGGCCTCCCCGTCAGCCGCCGCTCCAACGGCGCTAGCCTCGGCAGCGTCAGCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCCATCGAG
GGCATCAAGAAGTTCGAGACCCTGTCTTACCTGCCACCGCTCAGCACGGAGGCCCTCCTCAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCTT
GCCTCGAGTTCAGCAAGGTTGGGTTCATCTTCCGTGAGCACAACGCATCTCCTGGGTACTACGATGGCCGGTATTGGACAATGTGGAAGCTGCCTATGTT
CGGGTGCACTGACGCCACACAGGTGATCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCGTATGTCCGCATCATCGGATTCGACAACATGCGT
CAGGTGCAGTGCGTCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACGACAGGCCATATATAAAGTGC
CATTGCAGTTTTGTCAACTCTGACATTGCTTTGGGTTTTCCTTCTCCATTTATCTTTCTTATTTGTTCCTAAGAATATGTGTATGTCCATGTTCATGTAC
CAACATGGCTCGAGAAAGCATGCTCGTATGTGAATGCTATCGGTGGCTATGTATATGCACGGACGCATAATATTATACAATATGTCAACTATATACGTTT
TAATGGTAACCAATGGAAAATATCTCCACCGCCGTGCTTATTACTTCCTTCATCCCAAAAAAAAAAA
page-top