Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2149
Contig Information
Length 1657 bp
Tissue Anther at meiosis
Clones 25 Clones [Download: CSV  ,  FASTA ]
whpc10a16    whpc5c05    whpc5d12    whpc8a20    whpc9k14    whpc14h01    whpc14h08    whpc14k14    whpc14o22    whpc17d12    whpc17i13    whpc17i16    whpc17j03    whpc18a18    whpc18d24    rwhpc5c05    rwhpc8a20    rwhpc9k14    rwhpc14h01    rwhpc14h08    rwhpc14k14    rwhpc17i13    rwhpc17i16    rwhpc17j03    rwhpc18d24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein NitaMp027 [Nicotiana tabacum] >gi|57014030|ref|YP_173501.1| hypothetical protein NitaMp164 [Nicotiana tabacum] >gi|56806536|dbj|BAD83437.1| hypothetical protein [Nicotiana tabacum] >gi|56806666|dbj|BAD83567.1| hypothetical protein [Nicotiana tabacum]
Score 271
Evalue 1.28065e-27
Total Hit Count 66
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2149
GCGGGCATTGAGAAGGAAGGACGCTTTCAGAGGCGAAAGGCCATGGGGAGAGATTTTTCTGTGATCCATGGATCTCCGATCGGGAAACCGTATCCAAGCT
CCGTGGCTAGTCTGCGCTCTTTGGACTTTTCAAACTTAGCGAACTGAAACATCTGAGTAGCTAAAGGAAGGAAAATCAACCGAGACCCCGTTAGTAGCGG
CGAGCGAGAGCGGAACAAGGGTTTTCATCAAAAGAAATCCGAAGCGGTTTCATTCGATTTGTTGTGGATTGGATGATGGAAAAACCAGCAAGCAGCAAGC
GTAGTTAGAAAAGTTGCCGTAGCGCGCCCTACGGAGTTGTACAAAGTCAGCAACCGTTTTGGGGCGCAAGCATAGGCAACACAGGACTGATGACGGGGTG
GGGCGCGCAGTGAACTGGTTTTCTAAAAAGATTGGAAGATCCGGCCAAAGAAGGTGATAGCCCTGTTCATTCGTTCCCATGGTTCGATCCTTCCCAGTAA
AACGCGGCGTGTTCGAATGATGATCGCTTTTACGCGAGAAAGGGGGACCACCCTCTAAGCCTAAGTATTCCTCAATGACCGATAGCGTACAAGTACCGTG
AGGGAAAGGTGAAAAGAACCCCAATCGGGGAGTGCAATAGAGAACCTGAGATCCGATGCGAACAATCAGTCGAAGGAGCGGAGCGCGGGCGCACTCACTC
TAACGGCGTACCTTTCGCATGATGGGTCAGCGAGGAAATGGGAACAGCGGCTTAAGCCATTAGGTGTAGGCGCTTTCCAGAGGTGGAAGATTTACGTTCT
TCCTATTTGACCCGAAACCGATCGATCTAGCCATGAGCAGGTTGAAGAGAGCTCTAACAGGCCTTGGAGGACCGAACCCACGTATGTGGCAAAATACGGG
GATGACTTGTGGCTAGGGGTGAAAGGCCAACCAAGATCGGATATAGCTGGTTTTCCGCGAAATCTATTTCAGTAGAGCGTATGATGTCGATGGCCCGAGG
TAGAGCACTCAATGGGCTAGGGTGGCCCCCATTTCGCTTTACCAACCCCAGGGAAACTCCGAATACAGGCCGTCATCCTTAGTACAGACAGACTGATTGG
GTGCTAAGATCCAAAGTCGAGAGGGAAACAGCCCAGATCGTACGCTAAGGTCCCTAAGCAATCACTTAGTGGAAAAGGAAGTGATCGAGCGATGACAACC
AGGAGGTGGGCTTGGAAGCAGCCATCCTTTGAAGAAAGCGTAATAGCTCACTGGTCTAGCTCCATGGCACCGAAAATGTCTCAGGGCTCAAGTGATTCAC
CGAAGCGACGAGACCTTGAAAGCAGCTTTTTCAAGTGTCAGTAGCGGGACGTTCTGTCAATCGGGGAAGGTTTTTGGTGACAAGACCTGGAGATATCAGA
AGTGAGAATGCTGACATGAGTAACGAGAAATCCTGTGAAAAACACGATCGCCTGCCAGTGGAAGGCTTTCTGCGTTCAGTCAATCTACGCAGAGTGAATC
GGTCCCTAAGGAACCCCCGAAAGGGCTGCCGTCCGATGGGTACACGAAAGTGACGAAGTTGCAAAAAAAAAAAAAAAAAAAAAAAANTNAAAAAANCNAA
AANNTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATNNTTNNAAAAA
page-top