Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2146
Contig Information
Length 807 bp
Tissue Anther at meiosis
Clones 23 Clones [Download: CSV  ,  FASTA ]
whpc10b07    whpc10k14    whpc11l12    whpc12c24    whpc1e04    whpc4j16    whpc4m10    whpc8j23    whpc14d24    whpc17i03    whpc18l19    rwhpc10b07    rwhpc10k14    rwhpc11l12    rwhpc12c24    rwhpc1e04    rwhpc4j16    rwhpc7l11    rwhpc8j23    rwhpc13e07    rwhpc14d24    rwhpc17i03    rwhpc18l19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit type 1 non specific lipid transfer protein precursor [Triticum aestivum] >gi|84617233|emb|CAH69212.1| type 1 non specific lipid transfer protein precursor [Triticum aestivum]
Score 493
Evalue 6.86531e-48
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2146
TTTTTTTTTTCAATAATTAGGAAAATAATTACTATTCATTAATTGCCTGAACAAGTAGGTCAGGCACATCACACGTACACATCGGCTACACTAGAGTACA
GCAAAGAGTTGACAGTTCACTCACGCATACGGACGCATGCATACATGTCGCATAAATATATATGCACACACAGTGTGTGCGCAAGGTACAGACATGGACA
CAGACACACAGTGACACAGTACTGAAATAACACACGCAAGCAACTTCATTTTATTATTTAGTAGCTCAGTATCGTATGAGCACTCCATCAACGTAGACAT
TAAGCTCCACACAAGCGCGTCCTTGCATGCACGTCGGAAGGGTTATATATTGAACTAGTTGACATTGTTGCAGTTGGTGGACATGCTGATGGGGAAGGGC
ACGCTGACGCCGCACTTGCCGGGCACGCCGGAGACCTTGTCCATGTTGATGGACTTGATGCTGGTGGCGAGGCTCTTGAGGCACCTGCACGCTATCTTGC
GGTCCGGGCTGCTGCGGGCCAGGCCGTTCAGCCCCTGCACACCGGAGCAGCACTCCTTGCTGATCGAGGGCGCCTTCCCCGTCACGTACGACACGCACGG
CGCGAGCTTGGAGTCCACCTGCCCGCACGACAGTGCCGTCGCCTCCCTGCCGGCCATCATTAGCACCACCGCCGCCAGGACCACGGCGGACACCACAGCC
TTGCTGTTGAGACGAGCCATCGATCGCTAGCTGGAAGTTCCTTAAGCTGCTAGCTAGCTAGTGGGTGATCAGATGAGTGTCGGCGGTGTGGTTAAGCTAG
TGGAGTG
page-top