Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2138
Contig Information
Length 858 bp
Tissue Anther at meiosis
Clones 19 Clones [Download: CSV  ,  FASTA ]
whpc10f19    whpc11b04    whpc11m10    whpc1h11    whpc2g23    whpc3a06    whpc4d19    whpc7j16    whpc14f21    rwhpc10f19    rwhpc11b04    rwhpc11m10    rwhpc1h11    rwhpc2g23    rwhpc3a06    rwhpc4d19    rwhpc4d20    rwhpc7j16    rwhpc14f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit eukaryotic translation initiation factor 5A1 [Triticum aestivum] >gi|78191541|gb|ABB29983.1| translation initiation factor 5A [Dasypyrum breviaristatum] >gi|78191543|gb|ABB29984.1| translation initiation factor 5A [Secale cereale] >gi|78191547|gb|ABB29986.1| translation initiation factor 5A [Aegilops tauschii]
Score 845
Evalue 1.17012e-88
Total Hit Count 450
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2138
TTTTAAATAACCCAAACCAATTCATTCATAGAGATAGGGCGGATGAGCAAACCGGAATCTAAGTTCCAGCCACCACTCAGTTCCAATTCCAAAGGGTATT
ATAATAGAGATAGATAGATAGATAACAAAGTACTAGCAGCACCTCGAGCATTCGGTGTAAAGAACACACAAATCTGGATCAAACTTGTTTCACCCAACAG
ATATCTTGATGCCTATGTATGTGTATCTCAAACACCCAGAAGCACTAGATACCAAGTATCGCAGGTAGGCAACCACGCACAGCTGCTTACTTGCCACCAC
CGATTTCCTTCACAGCGCAGATCTGTTCTTCACCCATGGCGGACATCACAGACAGGATCAGGTCCTTGCCATCAGCAAATCCAGTCTTGATCTGGCCAAG
CAGAACATCATCAGTGGGAAGCTTCAGGTCATCCTTCGTGTTGCCACTCTCAGTTAGAAGGCTGACATATCCATCATCAGTTATGTCAATCAGCTGATAA
TCTTGGCGGTCAACATGGGGGACGTCACAGTTGTGGGATGAAGGAACGATATCCTCAAGCTTCTTTCCATTAAAGATGTCAATGGCAACAAAGTGACACT
TTGCGTGACCATGCTTCCCAGTCTTGGAGGTGGAGACCTCAACAACCTTGCAGGGACGGGCCTTGATGACGATGTGTCCACCCTTGCGGATGGCGCCGGC
CTGCTGCGGGTAGGTCTTGGAGGCGCCGGAGTCGGCCTTGGACTCGAAGTGGTGCTCATCGGTGTCCGACATCTCCGACGATCCTCCTGAGTCCGGGGGC
AAGTGGGGTGGTGGAGACGAGACGCAGCGGCAGCGAGGGGCGGATGGACGGCACGAGG
page-top