Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2136
Contig Information
Length 885 bp
Tissue Anther at meiosis
Clones 18 Clones [Download: CSV  ,  FASTA ]
whpc10f16    whpc11c16    whpc11e03    whpc1f20    whpc2f24    whpc7k21    whpc9l13    whpc16o21    rwhpc10f16    rwhpc11c16    rwhpc11e03    rwhpc12l16    rwhpc1f20    rwhpc2f24    rwhpc7k21    rwhpc9l13    rwhpc13i09    rwhpc16o21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=HMG1/2-like protein >gi|21803|emb|CAA77641.1| high mobility group protein [Triticum aestivum] >gi|114145392|dbj|BAF30985.1| high mobility globular protein [Triticum aestivum]
Score 359
Evalue 2.77567e-32
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2136
TTTTTTTTTTAATCTAACATTACCCAGACTGATATTATCACAATGTTAGCCGGTGACAATGGACGGAAAGAGTAACCATCTAGGTACAAGCAGGGGCACC
CCGCGGAAGAGGACATACACCCTCCACCACTAGGGCATCCCCGCCGGCGGCGGCGCCAACAGGGAGCGCTATCCGTTATAGCAGGACAATGACAGGAAAA
AGGTAAAACAACATCACGATGTGAAGTGAAACTTGGGATAATTCTAGTGGAGATGGATAGGCTCCTTATGACACCACCGCACACAGCTCAGGTCCGTTCT
CGCACAGCAGCTCCCGACTTGTCCGCCGGAGCAGCCTTGACAAGATGCGTCTTCTTCACTCGTCATCGTCCTCGTCCTCATCGCTGCCCTCATCGTCATC
GTCGTCATTGATCTCCGACTTGGACTTGTCAGATTCCTCCTCATCTTCCTCCTCTACCTCCTTGGCCGCAGCCTTCTTTGGGGCAGCAGCAGCAGCGCTC
TCGCCCTTGTTGTAGGCAGCAATGGCCTTGTTGTACTCGCCCTTGAGCTTGTTGGCCTTGGCCACATAGGGGGCCTTTTCCGATTCGCTCAAGCTCTTCC
ACCTCTCACCGGCCGCTTTGCCGACGGCGGCGACGGACTTGTTCTTGGGGTTCTTCTGCTTGAACTCCTCGCGGAACTCGCCCATGAAGACGAAGAAGGC
GGATGGCGCCCTCTTGGGCTTGTTGGGGTCCTTGCCGGCCTTGCCCTTCTTCCCCTTGGCGGCCGGCTTCTCCGCCCCCTTGCTCTTCACCGCCAACTTG
GCGTCGGCCTTGGCGGCGCCCTTGGATTTGGCCCCCTTCATGGCTGGTTTCCTGGGGGGAGGGGGCGGGGGAGAGAGGGCGCTCC
page-top