Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2126
Contig Information
Length 2235 bp
Tissue Anther at meiosis
Clones 16 Clones [Download: CSV  ,  FASTA ]
whpc10i12    whpc12g16    whpc1b24    whpc9i16    whpc17o02    whpc19j17    rwhpc10i12    rwhpc12g16    rwhpc12h03    rwhpc12h04    rwhpc1b24    rwhpc9i16    rwhpc13b12    rwhpc17o02    rwhpc19j17    rwhpc20k08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0276500 [Oryza sativa (japonica cultivar-group)] >gi|108707463|gb|ABF95258.1| Heat shock cognate 70 kDa protein, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548183|dbj|BAF11626.1| Os03g0276500 [Oryza sativa (japonica cultivar-group)] >gi|125585779|gb|EAZ26443.1| hypothetical protein OsJ_009926 [Oryza sativa (japonica cultivar-group)] >gi|215706307|dbj|BAG93163.1| unnamed protein product [Oryza sativa Japonica Group]
Score 3102
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2126
TTTTTTTTTTAACTGCAGATAACCAAGTATACTGTCTTCTAGTACTAAATAATCGTGTTTCAATATCAACTTAAACATAAGATGGGGCAATGTATATATG
CCCGAACGAAAAACTGCAGAACGATACTAGAATCCACCGTACAATGAAAGACACATTATTCAAGCAGAATAGTAGGCGATCTAAATCTATCATTTAGTCG
ACCTCCTCAATCTTGGGCCCTGGGCCGCTGCTGCCGCCTGCGGCACTGGCCGGAGCATCCTCATCCATGCCACCAGGCATTTCAGCGCCGGCACCCTGGT
ACATCTTGGCGATGATGGGGTTGCAAATGCCCTCCAGCTCTTTCCTCTTGTCATCAAACTCTTCAGCCTCGGCGAGCTGGTTGTTGTCGAGCCAGGTGAT
GGCACCATCGATAGCATCCTCGATCTTCTTCTTGTCGGCCTCTGGGAGCTTGGAGGCGATCTTGTCATCCTTGATGGTGTTACGCATGTTGTAAGCGTAG
TTCTCCAGGGCGTTCTTGGAGTCCACCTTCTTCTTGTGCTCCTCGTCCTCAGCCTTGTACTTCTCGGCCTCCTGCACCATCTTCTCGATGTCCTCCTTGC
TCAGCCGCCCCTTGTCGTTGGTAATTGTGATCTTGTTCTTCTGTCCGGTGGTCTTGTCCTCCGCCGAGACATTCAGGATACCGTTGGCATCAATGTCAAA
GCACACGGTGATCTGGGGGACACCCCTGGGCGCCGGTGGGATCCCGGAGAGCTCGAACTTGCCGAGCAGGTTGTTGTCCTTGGTCCTCGCCCTCTCGCCC
TCATACACCTGGATGAGCACGCCGGGCTGGTTGTCAGAGTAGGTGGAGAAGACCTGCTCCTTCTTGGTGGGGATTGTCGTGTTCCTTGGGATCAGCACGG
TCATGACACCTCCGGCCGTCTCCAGGCCCTGCGAGAGCGGTGTGACGTCAAGCAGGAGCAAGTCCTGCACCTTCTCGTTGCCCTCGCCAGTGAGGATGGC
AGCCTGAACGGCGGCTCCATACGCGACGGCCTCGTCAGGGTTGATGCTCTTGCAGAGCTCCTTCCCGTTAAAGAAGTCCTGGAGGAGCTGCTGCACACGG
GGGATACGTGTGGATCCTCCGACGAGGACAACATCGTGCACGGTGCTCTTGTCCATCTTGGCGTCCCGGAGGCACTTCTCAACGGGCTCCATGCACTTGC
GGAAGAGGTCCATGTTGAGCTCCTCGAACCGGGCGCGGGTGATGGTAGTGTAGAAGTCGATGCCCTCGAAGAGGGAATCGATCTCGATGGTGGTCTGGGC
GGTGGAGGAGAGTGTCCTCTTCGCCCTCTCGCACGCTGTCCTGAGCCGCCGGAGCGCCCTCGGGTTGCCGCTGATGTCCTTCTTGTTCTTTCTCTTGAAT
TCCTGCACGAAGTGGTTGACCATCCGGTTGTCGAAGTCCTCGCCTCCCAGGTGGGTGTCTCCGGCAGTGGCCTTGACCTCGAAGATACCCTCCTCAATGG
TGAGGAGCGAGACATCGAAGGTACCGCCGCCGAGATCAAAGATGAGCACGTTCTTCTCGCCGACGCTGGTGGACTTCTTGTCGAGACCGTAGGCGATGGC
GGCGGCGGTAGGCTCGTTGATGATCCGCATGACGTTGAGGCCAGAGATGACGCCTGCATCCTTGGTGGCCTGGCGCTGGGAGTCGTTGAAGTAGGCGGGG
ACGGTGACGACTGCGTTCTTGATGGTTGTGCCGAGGTAGGCCTCGGCCGTCTCCTTCATCTTGTTGAGCACCATGGAGGAGATCTCCTCGGCCGAGAACT
GCTTGTCCTCGCCTCTGTACTGTACCCCGATCATCGGCTTGTCAGCGGGGCCTGGGATCACCTTGAACGGCCACAGCTTGGCGTCGCTCTGCACCGACGC
GTCCGAGAAACGCCGACCGATGAGCCGCTTCGCATCGAAGACGGTGTTGATCGGGTTCATGGCGACCTGGTTCTTCGCGGCGTCGCCGATGAGCCGCTCG
GTGTCGGTGAAGGCGACATAGGACGGCGTGGTGCGGTTGCCCTGGTCGTTGGCGATGATCTCCACCCGGTCATGCTGCCAGACGCCGACGCAGGAGTAGG
TGGTGCCGAGATCGATGCCGATCGCCGGCCCGTCTCCTTTTCCGGCCATGATCTCGTCGACAAGTCGAGCGGAAAAAACAACCTCGAAGGGAATTGCGGG
AATTGGTTGGATTTTGGAGCGGAGCACGCGGGTAA
page-top