Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2113
Contig Information
Length 1109 bp
Tissue Anther at meiosis
Clones 14 Clones [Download: CSV  ,  FASTA ]
whpc10e05    whpc10e06    whpc10m22    whpc10n09    whpc12h12    whpc12h23    whpc13i24    rwhpc10e05    rwhpc10e06    rwhpc10m22    rwhpc10n09    rwhpc12h12    rwhpc12h23    rwhpc13i24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Mitochondrial outer membrane porin; AltName: Full=Voltage-dependent anion-selective channel protein; Short=VDAC >gi|456672|emb|CAA54788.1| voltage dependent anion channel (VDAC) [Triticum aestivum]
Score 1353
Evalue 2.19566e-147
Total Hit Count 415
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2113
AAACCCACGCAGCTCCAGCGGCGCAGGCGCATCCCAGCTCACCGGCGGAGATGGGCGGCCCAGGCCTCTACTCCGGGATCGGCAAGAAGGCCAAGGATCT
GCTATACAGGGACTACCAGACCGACCACAAGTTCACCCTCACCACCTACACCGCCAATGGCGCCGCAATTACTGCTACCAGTACAAAGAAGGCTGATCTT
ATACTTGGTGAGATCCAATCACAGATCAAGAACAAAAACATCACTGTAGATGTGAAGGCAAACTCAGCATCGAATGTCATTACTACAATTACCGCTGACG
ATCTTGCAGCACCAGGGCTGAAGACCATCTTGAGCTTTGCTGTTCCTGATCAGAAATCTGGAAAGGTTGAGCTCCAGTACTTGCATGATTATGCTGGTAT
TAATGCAAGCATTGGCTTGACTGCCAATCCTGTAGTCAACCTCTCCGGTGCGTTCGGAACTAGTGCTCTAGCTGTTGGTGCTGATGTGTCGCTTGATACA
GCCACCAAGAATTTCACCAAATACAATGCTGCACTTAGCTACACTAACCAGGATCTTATTGCATCCCTGAACCTGAACAACAAGGGAGACAGCCTGACCG
CATCCTATTACCACATTGTGGAGAAGTCCGGCACAGCTGTCGGGGCGGAGCTGACCCACAGCTTCTCGAGCAACGAGAACAGCCTCACCTTTGGCACCCA
GCATACCCTGGACCCGCTCACCCTTGTGAAGGCCCGGATCAACAACTCTGGCAAGGCCAGCGCGCTGATCCAGCACGAGTTCATGCCAAAGTCGTTGTGC
ACCATCTCGGCGGAGGTGGACACCAAGGCCATCGAGAAGAGCTCGAAGGTCGGCATTGCTATTGCTCTCAAGCCTTGATTGCGAAATCAAGCCCCCCATT
CTCTAAAGCTCTCAGTCAGGGGTGTTCCTCGGTTTCGGATGAAATCGGGGCGGGTTGACAATACTTCACACGCCTTGGGCGCGTTGTTGCAGTCTGTTAG
ATTTGAAGAACTGCCGTGTTTCATTCCTGAGGAATTTTGTCTTTGCTCGGTGTAGTGCCTGTCCGTTGAGCCACACTTCTCAGTAATAATTCAAGCTCTG
AAAATTCAA
page-top