Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2106
Contig Information
Length 951 bp
Tissue Anther at meiosis
Clones 12 Clones [Download: CSV  ,  FASTA ]
whpc2m03    whpc8h01    whpc8h22    whpc13b16    whpc14a11    whpc14m03    rwhpc2m03    rwhpc8h01    rwhpc8h22    rwhpc13b16    rwhpc14a11    rwhpc14m03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit polyubiquitin containing 7 ubiquitin monomers [Zea mays]
Score 1150
Evalue 5.9315e-124
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2106
TCTCGTCTCCGATCGACCCGAGGCTCGTCGAACCCTTCTTCCCCACCGCCTCAAGATGCAGATCTTCGTGAAGACACTCACGGGCAAGACCATCACCCTT
GAGGTGGAGTCGTCTGACACCATCGACAACGTGAAGGCCAAGATCCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTTATCTTCGCTGGCAAGC
AGCTGGAGGACGGTCGCACCCTTGCCGACTACAACATCCAGAAGGAATCCACCCTCCACCTGGTGCTCCGCCTGCGTGGTGGCATGCAGATCTTCGTGAA
GACCCTCACCGGCAAGACCATCACTCTGGAGGTTGATAGCTCCGACACCATTGACAACGTCAAGGCTAAGATCCAGGACAAGGAGGGCATTCCCCCGGAC
CAGCAGCGCCTTATCTTCGCAGGCAAGCAGCTGGAGGATGGTCGCACCCTTGCCGACTACAACATCCAGAAGGAGTCCACCCTTCACCTGGTGCTCCGCC
TCCGTGGTGGTATGCAGATTTTCGTGAAGACCCTCACCGGCAAGACTATCACCCTTGAGGTTGAGAGCTCTGACACCATCGACAACGTCAAGACCAAGAT
CCAGGACAAGGAGGGCATTCCCCCGGACCAGCAGCGCCTCATCTTCGCCGGCAAGCAGCTGGAGGATGGCCGCACCCTTGCGGACTACAACATCCAGAAG
GAGTCCACCCTCCACCTGGTGCTCCGCCTCCGCGGTGGTCAGTAATTGCCCTGGCGTTGGACCTGCTGGTTTATCCTTGGTCGTCCGGTTGGTGGTACCC
TGTCGTTCATTTGAACTGTTTTCTTGTTCGTGTCAGTCCTATGTGTTGGTTTGAAAACTATCGAGTCCCCATGTTATATGTTGGTTGAAAATGTTGCTGG
CACAGAAGTATCGTCAAGTAATGAATAAGTGAATTTCAGACAAAAAAAAAA
page-top