Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2053
Contig Information
Length 876 bp
Tissue Anther at meiosis
Clones 9 Clones [Download: CSV  ,  FASTA ]
whpc10a08    whpc12p10    whpc5m22    whpc18e11    whpc18e23    rwhpc10a08    rwhpc12p10    rwhpc5m22    rwhpc5n09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Superoxide dismutase 1, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|125586252|gb|EAZ26916.1| hypothetical protein OsJ_010399 [Oryza sativa (japonica cultivar-group)]
Score 726
Evalue 7.56948e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2053
TCCATTCATCATCCCATCCCCCAAGTCATAAACCCAAGTCGGACTCGCCTTCCTCCTCCCCCAACTACTCCTCCTCGCCTCCGCGCATCGCACCGCACCG
GGGGTCACCTGAGATCACATACACAATGGTGAAGGCTGTGGCTGTGCTTACCGGCAGTGAGGGTGTCAAGGGCACCATCTTCTTCACCCAGGAGGGAGAT
GGCCCGACCACCGTGACGGGAAGTGTCACTGGACTCAAGGAAGGGCTCCACGGCTTCCATGTGCACGCTCTTGGTGACACCACCAATGGCTGCATGTCAA
CTGGACCACACTTCAACCCCGCTGGTCATGTGCATGGGGCACCCGAAGATGAAATCCGCCATGCTGGTGATCTTGGAAATGTGACAGCTGGAGCGGATGG
TGTTGCTAACATCAATGTTACTGACTGCCATATCCCCCTTACTGGACCAAATTCAATTGTTGGCCGTGCTGTTGTCGTCCATGGTGACGCTGATGATCTT
GGCAAGGGTGGACATGAGCTGAGCAAGAGCACTGGAAACGCTGGTGCCCGTGTTGCTTGCGGAATCATCGGGCTCCAGGGCTAGATGTCATCTTCGCCGA
CCAACGTCGTACAGATCTGGGAACCTTTTCAGAATGCAGATTTGCAATCTCTATTCTAAATAAGCACATGATCTTTGATCACTTGTTAGTGTGCACCATT
CATGTCAATTCCAATGTGCTACTCTGAACTTTATCACTGTCATTTGGCTATGATTTGCGTGACTGGAACAGTTGTCAAGTGCTTGTGGATCTGCTGTTGT
TCTTTAAGCCGCTACCAGCTCTGGACATATTTACAGAAAACGAGAGAGATTTCAGATTTCATCTTAAAAAAAAAAA
page-top