Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig2046
Contig Information
Length 1435 bp
Tissue Anther at meiosis
Clones 9 Clones [Download: CSV  ,  FASTA ]
whpc10h02    whpc7g16    whpc15f08    whpc15f19    whpc15o16    rwhpc10h02    rwhpc7g16    rwhpc15f08    rwhpc15o16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alcohol dehydrogenase ADH1A [Triticum aestivum] >gi|119388731|gb|ABL74262.1| alcohol dehydrogenase ADH1A [Triticum turgidum subsp. dicoccon]
Score 1851
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig2046
AGTGAGAGATCAGTTCTCGATTTCGATTCCGGTTCCGCTCAGAGAATTCCCCAGGCGAGCGAGCGAGATGGCGACCGCCGGGAAGGTGATCAAGTGCAAA
GCCGCGGTGGCGTGGGAGGCGGGGAAGCCGCTGTCCATGGAGGAGGTGGAGGTGGCGCCGCCGCAGGCCATGGAGGTGCGCGTCAAGATCCTCTTCACCT
CCCTCTGCCACACCGACGTCTACTTCTGGGAGGCCAAGGGGCAGACTCCCATGTTCCCTCGGATCTTCGGTCATGAAGCTGGAGGCATAGTGGAGAGTGT
TGGAGAGGGTGTGACTGAGCTTGCCCCTGGTGACCATGTCCTCCCTGTGTTCACTGGGGAGTGTAAGGAATGCCCACATTGCAAGTCTGCAGAGAGCAAC
ATGTGTGATCTGCTCAGGATCAACACCGACAGAGGTGTCATGATCGGGGATGGCAAGTCACGCTTCTCTATTGACGGGAAGCCGATTTACCATTTCGTAG
GGACTTCCACCTTCAGTGAGTATACTGTCATGCATGTTGGTTGTGTTGCCAAGATCAACCCTGAGGCTCCCCTTGACAAAGTCTGCGTTCTTAGCTGTGG
TATTTCCACTGGTCTTGGCGCATCCATTAATGTTGCAAAACCACCAAAGGGTTCGACAGTGGCGATATTTGGGCTAGGAGCTGTTGGCCTTGCTGCTGCA
GAAGGTGCAAGGATTGCAGGTGCATCAAGGATCATTGGTGTTGACTTGAACGCCAGCAGATTTGAAGAAGCTAGAAAATTTGGCTGCACGGAATTTGTGA
ACCCGAAAGATCACACCAAGCCAGTTCAACAGGTGCTCGCTGAGATGACAAATGGTGGAGTTGACCGCAGTGTTGAGTGCACGGGCAACGTCAATGCTAT
GATACAAGCATTTGAATGTGTTCATGATGGCTGGGGTGTAGCTGTGCTGGTGGGTGTGCCGCACAAGGATGCCGAATTCAAGACCCACCCGATGAACTTC
CTGAACGAGAGGACTCTCAAGGGCACCTTCTTCGGAAACTTCAAGCCGCGCACTGACCTGCCCAATGTCGTGGAGATGTACATGAGAAAGGAGCTGGAGG
TGGAGAAGTTCATCACACACAGCGTGCCGTTCTCGGAGATCAACAAGGCATTCGACCTCATGGCGAAGGGCGAGGGCATCCGCTGCATCATCCGCATGGA
GAACTAAGCCGCCTCACGCGCTTCTGATCGCTCCGATGTAATAAGCGCTGGGGTGCGGTTTCTGAACAAGATCATCGTCTGTGGTTTCGCCTTCCTTGGC
AAAGTAGCGTAGTATTAGTTCAAGTATATCTGTAATTACGTACCGGACAAGTGGCTGTACTACGAACGAGCTCTCTTTTGGCAGCAATATATGCTGCTGC
TACTACTACTATGGCCATGAGTTTCAAAAAAAAAA
page-top