Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1994
Contig Information
Length 934 bp
Tissue Anther at meiosis
Clones 8 Clones [Download: CSV  ,  FASTA ]
whpc10f18    whpc11o16    whpc7k11    whpc9e17    rwhpc10f18    rwhpc11o16    rwhpc7k11    rwhpc9e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal subunit 8E protein [Brachypodium sylvaticum]
Score 841
Evalue 3.94573e-88
Total Hit Count 429
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1994
GAATTCGGCACGAGGGCTGCGGCGGCGCGCGCATAGGAGGCGAAGCAGCAGCGGAGCCAAGCCACCGACGCCACCATGGGTATCTCGCGTGACTCCATGC
ACAAGCGCCGGGCCACCGGTGGGAAGCAGAAGGCGTGGAGGAAGAAGCGAAAGTATGAGCTCGGCCGCCAGCCAGCCAACACTAAGCTTTCGAGCAACAA
GACAGTGAGGAGGGTCCGTGTTCGCGGAGGTAACGTGAAGTGGAGGGCTCTCCGTCTGGACACTGGTAACTTCTCATGGGGTAGTGAGGCTGTGACCCGC
AAGACCCGTCTCCTGGATGTGGTTTACAATTCGTCAAACAATGAGCTTGTGAGGACTCAGACCCTTGTCAAGAATGCCATTGTGCAAGTTGATGCTGCCC
CTTTCAAGCAGTGGTACCTGACTCATTATGGAGTGGAAATCGGTAGGAAGAAGAAAGCTGCTGCAGCTGCCAAGAAGGATGCTGCTGAGGGACAAGAGTC
TGAGGTTGCTGCTGCTGCCACAGAGGAAGCAAAGAAGAGCAACAATGTCCAGAGGAAGCTTGAGAAGCGCCAGCAGGGACGTACACTGGACTCTCACATT
GAGGAGCAGTTCAGCGGTGGAAGGCTGCTGGCCTGCATTTCGTCTCGCCCTGGACAGTGTGGCAGAGCTGATGGGTACATCCTGGAGGGCAAGGAGCTGG
AGTTCTACATGAGGAAGCTCCAGAAGAAGAAGGGCAAGGGTGCCACAGCTTAGGCTGAAGAGCTGCTGCATGTTACTTGTTGGATTTTCTTAGATGTTGC
GTCCATGTCATGTTTGCAGACATACTGAACACCATTTTCTGTAAACTGTTCGAGTCCTAGGTTGAACTGAGAATGTTTTTCCTGTTTTGGTTGTGATCTA
AAGCTATCCAGATTCTATTATGTGTTGTTCTACC
page-top