Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1974
Contig Information
Length 853 bp
Tissue Anther at meiosis
Clones 7 Clones [Download: CSV  ,  FASTA ]
whpc10c22    whpc9d10    rwhpc10c09    rwhpc10c10    rwhpc10c22    rwhpc9d10    rwhpc9d21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=HMG1/2-like protein >gi|21803|emb|CAA77641.1| high mobility group protein [Triticum aestivum] >gi|114145392|dbj|BAF30985.1| high mobility globular protein [Triticum aestivum]
Score 359
Evalue 2.632e-32
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1974
TGTTAGCCGGTGGACAATGGACGGAAAGAGTAACCAACCATCTAGGTACAAGCAGGGGAGCACCCGGCGGCAGAGGACATACACCCTCCGCCGCCAGGGC
ACCACCCCCGCCGGCGTCGGCGCCAACAGGGAGCGCTGTCCGTTATAGCAGGCAGCGGGACGACGACAAGAAAAAAAAGGTAAAACAACATCACGATGTG
AAGTGAAACTTGGGATAACTCTAGTGGAGATGGACAGGCTCCTTATGACACCACCGCACACAGCTCACGTCGGTTCTCGCGCAGCAGCCGCTCCCGCCTT
TGTCCGCCGGAGCCAGCAGCCTTGACAAGATGCGTCTTCTTCACTCGTCGTCGTCCTCGTCCTCATCGCTACCCTCATCGTCATCGTCGTCATTGATCTC
CGACTTGGACTTGTCGGATTCCTCCTCATCTTCCTCCTCCACCTCCTTGGCGGCCGCCTTCTTTGGGGCGGCAGCAGCAGCACTCTCGCCCTTGTTGTAG
GCGGCGATGGCCTTGTTGTACTCGCCCTTGAGCTTGTTGGCCTTGGCCACGTAGGGGGCCTTCTCCGATTCGCTCAAGCTCTTCCACCTCTCACCGGCCG
CTTTGCCGACGGCGGCGACGGACTTGTTCTTGGGGTTCTTCTGCTTGAACTCCTCGCGGAACTCGCCCATGAAGACGAAGAAGGCGGAGGGCGCCCTCTT
GGGCTTGTTGGGGTCCTTGCCGGCCTTGCCCTTCTTCCCCTTGGCCGCCGGCTTCTCCGCCCCCTTGCTCTTCACCGCCAACTTGGTGTCGGCCTTGGCG
GCGCCCTTGGATTTGGCCCCCTTCATGGCTGGTGGGTTTCCCTGGGTGGGGAG
page-top