Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1965
Contig Information
Length 1093 bp
Tissue Anther at meiosis
Clones 7 Clones [Download: CSV  ,  FASTA ]
whpc10d10    whpc10l09    whpc10l11    rwhpc10d10    rwhpc10l09    rwhpc10l11    rwhpc12a04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein SNOG_00143 [Phaeosphaeria nodorum SN15] >gi|160700948|gb|EAT91638.2| hypothetical protein SNOG_00143 [Phaeosphaeria nodorum SN15]
Score 85
Evalue 2.30801
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1965
ATAACTTGATCATAAACCCACAATTCATCGTGATCTTGACAAACACACCGCAAAAAGAGATTACATCGAATAGATCTCCACAAGAAAGGGGGAAAACATT
GTATTGAGATCCAAAAAGAGAGAAGAAGTCATCTAGCTAATAACTATGCACCCGTAGGTTTGTGGTAAACTACTCACAACTCATCGGAGGGGCAAGGATA
TTGATGTAGAGGCCCTCCATGATCGATTACCCCTCCGGCGGAGTGCCGGCGAAGGCTCCAAGAAGGCATCTCGCGGATACAGACTGTTACGACGGTGGAA
ATTGTGTTTCGTTGTGCTCCTGGATGTTTTCGGGGTACGTAGGTATATATAGGAGGAAAAACTACGTCGGTGGCCGCCCGAGAGGCCTACGAGATAGGGG
GGCGCCCTCCTATCTCGTGGCCGCCTCGGCTGCTTCTTGGCTTGCACTCCAAGTCCTCCGGATCACGTTCGTTCCAAAAATCACGCTCCCGAAGGTTTCA
TTCCGTTTGGGCTCCGTTTGATATTCCTTTTCTTCAAAATACTGAAATAGGCAAAAAAACAGCAATACGGGCTGGGCCTCCAGTTAGTAGGTTAGTCCCA
AAAATGATATAAATGTGTAAAATAAAGCCCATAAACATCCAAAAGGGGTAATATAATAGCATGAAACAATCAAAAATTATAGATACGTTGGAAACATATC
AGCGTGTCAGCATTACTGATCCAGGGATGACACTAAAGCACAGAGATCAGACTGTTTGAGGTCTGGTCGCTACATTACTCCCGCTGTCGCCGCTGCTTTG
CTCATTTTTCATATGGATGGCAAGGATGCATGAAGACCATCTGTACACATATTCACGTATATGTCTTGCCCTAGAGGCTAGATCCGCCTAATCACTGTGG
CCACCGCCACTGCTTTGTTGATGTTGTCATCTAGATGCTGAGGATGCATGAGGACCAGAAAAAACTCTCTGTATTTGTCGCTATTGTTAGGTCTTTGTTT
TTCCTAAAAATCTCCTCTCTAATTGTCGATGTTATTAGGCCCCTGTTTTCCTTATGTTGTTGCCTCAACCTTAGCTGCTACAGGTCCAAGATG
page-top