Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1928
Contig Information
Length 1601 bp
Tissue Anther at meiosis
Clones 6 Clones [Download: CSV  ,  FASTA ]
whpc11e21    whpc1f14    whpc3f10    rwhpc11e21    rwhpc1f14    rwhpc3f10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Enolase, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 2224
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1928
GCTCTCCGCTCCATTCGATTCGATCTCGGCTTCCTCTCCAAGCCACGCGACGCGAGACCAGAGCTCCGGCCATGGCGGCGACGATCCAGTCCGTGAAGGC
CCGCCAGATCTTCGACAGCCGCGGCAACCCCACCGTCGAGGTTGATGTGTGCTGCTCAGATGGAACCTTTGCCAGGGCCGCCGTTCCCAGCGGTGCATCG
ACTGGTGTCTATGAAGCTTTGGAGCTGAGGGACGGTGGATCTGACTACTTGGGCAAGGGTGTTTCCAAGGCTGTTAACAATGTGAACTCCATTATTGCAC
CCGCTTTGGTCGGCAAGGACCCTACCGCTCAAACTGAGCTCGACAACTTTATGGTTCAGCAGCTTGATGGAACCAAGAATGAGTGGGGTTGGTGCAAGCA
AAAGCTTGGTGCTAATGCAATCCTGGCTGTATCACTAGCTGTTTGCAAAGCTGGAGCCAGCGTCAAGAAGATTCCACTGTACCAGCACATTGCCAACCTT
GCTGGCAACAAGCAATTGGTTTTGCCCGTTCCTGCGTTCAATGTCATCAATGGTGGATCCCATGCTGGAAACAAGCTTGCTATGCAGGAGTTCATGATCC
TTCCTACTGGAGCTGCCTCATTCAAGGAGGCAATGAAGATGGGCGTTGAAGTGTACCACAACTTGAAGTCTGTTATCAAGAAGAAGTACGGGCAGGATGC
CACCAATGTCGGAGATGAAGGTGGTTTTGCTCCTAACATTCAGGAGAACAAGGAGGGCCTTGAGCTCTTGAAGACTGCAATTGAAAAGGCTGGATACACC
GGCAAGGTTGTCATTGGAATGGATGTTGCTGCTTCAGAGTTCTACAATGACAAGGACAAAACCTATGACCTCAACTTCAAGGAAGAGAACAACGATGGTT
CCCAGAAGATATCTGGAGATAGCCTGAAGAACGTATACAAGTCATTCGTGAGCGAGTACCCCATTGTGTCGATTGAGGACCCGTTTGACCAGGATGACTG
GGTGCACTATGCTAAGATGACTGAAGAATGTGGAGTGGAAGTTCAGATTGTTGGTGATGACCTTCTAGTCACCAACCCAACCAGAGTTGCGAAGGCAATC
CAGGAGAAGTCATGCAATGCTCTTCTGCTGAAGGTTAACCAAATTGGATCCGTCACTGAGAGTATCGAGGCCGTGAAGATGTCAAAACATGCTGGCTGGG
GTGTGATGACCAGTCACAGGAGTGGTGAGACCGAGGACACATTCATTGCTGATTTGGCTGTTGGTCTGTCCACGGGTCAGATCAAGACCGGGGCTCCCTG
CCGCTCAGAGCGTCTTGCCAAGTACAACCAGCTTCTGAGGATCGAGGAGGAGCTGGGCGACGCTGCAGTGTATGCTGGCCTCAAGTTCCGTGCACCGGTG
GAGCCCTACTAGATGGGATCTGCACGAGTTTTTGTGAAAATGGGTGTGTTTAACCTCCGGAATGAACTCTGGTTGAAGCTCTTAGGATTGAGCAATAATG
AATGCCGCGCATGTTTTATGTGAACGGAACGGATATGTACCCCCAAACTTGCTCCAATTTTGGTCCTTGTGGATATGTACCTGATTCGGCCCTGAACCTT
T
page-top