Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1927
Contig Information
Length 832 bp
Tissue Anther at meiosis
Clones 6 Clones [Download: CSV  ,  FASTA ]
whpc10e03    whpc10e04    whpc10n08    rwhpc10e03    rwhpc10e04    rwhpc10n08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit aspartic proteinase [Triticum aestivum]
Score 1017
Evalue 1.25954e-108
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1927
TTTTTTTTTTCTAGAAGGCAAACGTTGTTTATCACATAATAATTCAACATCTTCGGGGCAAACGTCCACAAACAGTCTTGCCATCTTAGGAACAACCCTT
GGTCATGTCAGGGTCTTTGAAAAGCAGCATGTAGCATATATATACACACACAGCACCGGTCAAATTCGGAGTAAAAAAGCTAAGCTCTCTCCCGGCGCAA
GTGTTCGCCTCCGCGGTGGGGCGCTCGCTCGACCACCCTTTCAGGCCGCCTTGGCGAATCCGACACGCAGCTTGCCGTAGTCGAAGACGGTGTGGTAGGG
GCCCATGAAAACGTCTCCCAGGATCCAGAGAGGACCGCGAGGAGGCGGGATGTCCATGGCTGTGAATCCACTGATGCACTGGGCAGCAGCTCCTTCGCCA
ACCTTCAGGATATACTCTTCTGGTTTCAGCGCAAACTTCTTGCCACTAATGGTGAACTCAATGTCAGGCATGGATCCAAGGCTGGCACAGTCCACAGCTG
ATTCTCCCATGGGGCTTGGCAGACGGTTGCACAGCTGGTTAACGTAATCTAGTATGAGATCCTGGGTCTTGTTCTGTGCAAGTTGGTTCTGCATCCACAC
AACAGCCATCTCACAGGCACTGCACATGGGATCGGTATGGAGGCCATTCGATTTCACAGGCTCATCATCGACCACGCTCCGAATTCCAGCACTAACACCA
CGAGTCCCATCAAAGGTGCACAGACCAACCTGGGAGCAGACCTTTTTGGGCTGTGTCTCTGCTAGCAACAGGTCGAGGATCTGTTGTCCATACTGAGAAA
CAATTGTTTTGCACTCTTGGCTGACTACCCCA
page-top