Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1921
Contig Information
Length 908 bp
Tissue Anther at meiosis
Clones 6 Clones [Download: CSV  ,  FASTA ]
whpc10e14    whpc10f01    whpc1h19    rwhpc10e14    rwhpc10f01    rwhpc1h19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0704900 [Oryza sativa (japonica cultivar-group)] >gi|122171022|sp|Q0DYB1|IPYR_ORYSJ RecName: Full=Soluble inorganic pyrophosphatase; AltName: Full=Pyrophosphate phospho-hydrolase; Short=PPase >gi|158512873|sp|A2X8Q3|IPYR_ORYSI RecName: Full=Soluble inorganic pyrophosphatase; AltName: Full=Pyrophosphate phospho-hydrolase; Short=PPase >gi|41053143|dbj|BAD08086.1| inorganic pyrophosphatase [Oryza sativa Japonica Group] >gi|113537394|dbj|BAF09777.1| Os02g0704900 [Oryza sativa (japonica cultivar-group)] >gi|125540818|gb|EAY87213.1| hypothetical protein OsI_08617 [Oryza sativa Indica Group] >gi|125583395|gb|EAZ24326.1| hypothetical protein OsJ_007809 [Oryza sativa (japonica cultivar-group)] >gi|215678927|dbj|BAG96357.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215686447|dbj|BAG87678.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215697839|dbj|BAG92032.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1066
Evalue 3.04244e-114
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1921
TATCGCGGCATCGGGTCCTGCGCTGCGCGCCTGCTGCTGCTCCCTCGCCCTCGCCTCCGCTGCCGTCGCGCGAGATCAACCCCGCCGCCATGGCTGGAGA
AGCTGATGGGAAGACCTACCAGGTATCAAGGATGCCCCCTGCTGCTCTCAACGAGCGCATCCTTTCTTCCATGTCTCAAAAGCACGTTGCTGCTCACCCA
TGGCATGACCTGGAGATAGGTCCAGGGGCCCCTGCAGTTTTCAACTGTGTGGTTGAGATTCCTAGAGGCAGCAAGGTTAAGTATGAGTTGGACAAAGCAA
CTGGTCTTATCAAGGTTGATCGTGTTCTGTACTCCTCAGTTGTGTACCCACACAACTATGGCTTCATTCCACGCACACTCTGTGAGGATAATGACCCGAT
GGATGTCCTTGTCCTGATGCAGGAACAAGTTGTTCCTGGTTGCTTCCTGCGTGCCCGTGCTATTGGGCTTATGCCTATGATTGATCAGGGTGAGAAAGAT
GACAAGATCATAGCTGTCTGTGCTGATGATCCTGAGTACCGTCACTTCAGAGACATCAGTGAACTTCCCCCGCATCGCCTACAGGAAATCCGTCGCTTCT
TTGAAGACTACAAGAAGAATGAAAACAAGGAGGTTGCAGTGAATGATTTCCTCCCAGCAGAAGATGCCATCAACGCAATCAAGTACTCGATGGACCTCTA
CGGTTCGTACATCATGGAGGGCTTAAGGAAGTGATCTCCAGTTGGTGGACTGCGGATGCTACGCGATCCGCCCTACGGCTTATCAATAGTACGACAGACA
TCTATGTTAACATGATGATCGAAAACCATCAGTCTGTTGGGGATCTATATATACCTTCTGTCCATGCTGAGTCAAGCATGGGGTACATTTTCCTTCCGTA
AAAAAAAA
page-top