Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1913
Contig Information
Length 1167 bp
Tissue Anther at meiosis
Clones 6 Clones [Download: CSV  ,  FASTA ]
whpc10g06    whpc10g17    whpc10i04    rwhpc10g06    rwhpc10g17    rwhpc10i04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ATP synthase beta subunit [Triticum aestivum]
Score 1435
Evalue 7.32954e-157
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1913
TTTTTTTTTTAAACCTGAACAAGAAACAGCTTCGCCAACAACAATAAACTAAACCAATTCATGATCTGTCGGATCTGCATTACAAAGGGCACAAGTGTTT
TCCAAGCCAAGAGTAGTGTTGCTGTTGTGCAGACTAAACCAATGTCACTGCAGTTGCTTATTACGGGTAAATTGGAGTAAAAACGAACAAAAACAAGGAT
CCCTCAGCAGGAGCTGGCACACTCCTGCTCGTGAGCAAGTCTCGGGCGAACAGCTGAAACCCAAAAAATTTAACTTGTACAGAGCGGTGGTAACACCTCG
TCATCAGGCATTCTCGCTGGCGATCTTCTCTGCCTTGGCGATGACTTCGTCGATGCCTCCAACCATGTAGAACGCGTGCTCCGAGATGTCGTCGTACTTG
CCGTCCAAAACACCCTGGAAACTTTGGACACCCTCCTTTAGGTCCACATACTTCCCTGGAGCACCAGTGAAAACTTCGGCAACATGGAAAGGCTGGCTCA
GGAACTTCTGGATCTTCCTTGCACGAGCAACCGTCATCTTATCATCTTCACTGAGCTCATCCATACCCAAAATGGCAATGATATCCTGAAGATTCTTATA
GTTCTGAAGAACCTTCTGGACACCACGGGCAGTGTTGTAGTGATCCACACCCAGAACGTGGGGAGAAAGCATTCTTGATGTCGAGTCCAAAGGATCGACA
GCAGGGTAAATGCCCAGCTCAGAAATCTGTCGTGACAACACAGTAGTAGCGTCAAGATGGGCAAAGGTGGTAGCAGGAGCAGGATCCGTCAAATCATCAG
CAGGCACATAAATAGCCTGGACAGATGTAATAGAACCCTTCTTTGTCGTCGTAATCCGCTCTTGCAGTCCTCCAAGATCGGTGGCAAGAGTTGGTTGGTA
TCCCACAGCAGATGGAATACGTCCAAGGAGAGCAGACACCTCAGAGTTTGCCTGGGTGAAACGGAAAATGTTGTCAATAAACAAGAGCACATCTTGTCCT
TCAGCGTCACGGAAATGTTCAGCAACAGTCAAACCAGTCAGACCAACACGAGCACGAGCACCCGGGGGCTCGTTCATTTGCCCGTAGACAAGAGCACACT
TGCTCTCAGCCTGCTTCTCATCAAGCTTAATGACACCACTTTCAATCATTTCCCTGTACCAAGTCAT
page-top