Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1834
Contig Information
Length 683 bp
Tissue Anther at meiosis
Clones 5 Clones [Download: CSV  ,  FASTA ]
whpc10d03    whpc12f17    whpc12f18    whpc13e05    whpc13e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit translation initiation factor IF-2 [Frankia alni ACN14a] >gi|122953804|sp|Q0RDS4|IF2_FRAAA RecName: Full=Translation initiation factor IF-2 >gi|111152651|emb|CAJ64392.1| Translation initiation factor IF-2 [Frankia alni ACN14a]
Score 102
Evalue 0.0108407
Total Hit Count 205
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1834
CTCGCCGCCGTTCCCCGCAACCTGTCTATCGACCCAATCTCACATCAACCGACGCCTCGTCCTCCTCTCCAGATCAGATCCCTGCCCGAGCTGGTAGCAG
CAACCAACTGTTCTGCTGCTGCAGCCTTCTTCGCCGCCAAAAGGAAAAGATGCTCTATGAAATCCACTCCCATGCCCAAATCCAAGACCTGCAGGCCCGC
TCCGATGAGCTGGGCCACTCCAATGAGCACATGGATGTGAAGCTTGTCTCTCTGGAGTCGGTGCGCATAGCGCGCGAGTCGTATGCACTCCTCTGGCCGC
TGACCAAGGAGCCGATGTCCTGGGCATGCCTGGAGCTGGATTCCCTCTCGGTCGTGGCAACCTTGTCGCTGGAAATCCAAAAGCTCGAGCATGATGTGTT
ACCCCAGCTCATGGTTCAGGAGTCCAAGCTGGAACGGGGCGCCCTGGAAGCCCTCCTAGTCATGCAGAACTCAGCAATTAAGCTCTTACATCTGGCGAAG
TGCTTTAAGGAATCCTTGGGCTTAGTGCTTGACGAGGAGGATCTGGTCTCAGCCCGAGTCGAAGAGCTGAGCATAGTGCTAAAGGATATTGCTGTTCATG
TACTCGAATATAATTGCAACATTGCCTGGATTCAANGTGCGTCTCCCGTGGCTGGTCCAGCGGGTCACCGATGTGTTGGAGAC
page-top