Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1785
Contig Information
Length 1505 bp
Tissue Anther at meiosis
Clones 5 Clones [Download: CSV  ,  FASTA ]
whpc12n09    whpc3h08    rwhpc12n09    rwhpc3h08    rwhpc20d21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cellulose synthase [Triticum aestivum]
Score 1986
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1785
TTTTTTTTTTAGAAACTCCTCCAAAATGTGAAGGACAGGAATAATTTATATAAATAATAAATACAAGAATTCATAGGTCCATTCCTACGATACAAAGTGC
CTCATAGGAAAATTCCTATAGGTTTACAATCCAATGAGATTCCTTTGTTCCAAAAAAAGATCTTAACCTCATGAAAACGGTAGATGGTCTATTACATCTA
TTTACAAATGTGTTTTCTCAATTTTGACAACTTTCTCAAACATAGTAATTCGCAACCCCAGCATAAATATTCTCTGGCTCCACAGGTGGTCGCTCGATCA
CTGTTATATTTTCTGTCTCTACAAACTCCCACTTTCCTAGCAGTTGATGCCACAGGTTTGGATATTTGGGCCAGCGAGACGGGTAGTGAATGGATCAACA
CGAACCCACAGCAAGGAGAAGATAGAAGCGAGGAGGACAGCCCAGACGATGACAATCGTCGGTGTGCGGTTTTGCCTGCCCATAAGACCCTTGAGGAATG
GGTATAAGTGAACAATCACCCAGAAGGCAAAGAAGAGCTTCCCAAAGAGCGGCCCCCATGATTGGTAACCACTGTTGATGGCGTAGGAGGTACCAGCAAC
GACACCGACCATGTTAATGATCAAAATGGTCGTCGGAGGGATAAGAAGCGTCGTCCACTTGAACATGTAGAGCTCAGCAAAGTCGCCTTCTTCATCATTA
GCCTTTGAGGTGACAGTGAAGTTGGTGTCGATACCGGCAAGCACCTTCAGAAGACCCTGAAAGACGGCAAACAGATGGGCAGAGATACCTCCAATGACCC
AGAACTGTTCATTCCTCCACCACTCGTCAATGCCAACACCACTCCACCTCATCTCAAGGATACCAGTGGCGAAAATTGAAAGGAAGAGAGCAATGAACCA
GATACTGGCCAAGTTGCTAATCTCTGGCATGATGAACTTTCCAGTGAGCAGACAGATAGCAGGCAATATACAATAGACTAGAAGCGGGAGAGAGGTTAGT
GGGTAAATGGTGGTGTTGATGTAAGCGAATCTCTCCAGGAACTTGAGGCGCCCTCCATACCCATACCATAAGGGGCAATGCCGGCTGAAAAGAATTTCAA
CAGAACCGAGAGCCCACCGCAGAACTTGGTTCAGACGATCTGAAAGATTGATGGGGGCAGATCCCTTGAAAGCTGGGCGCTTCGGCATGCAATAGACTGA
ACGCCAGCCTCTTGCGTGCATCTTGAATCCAGTGAGAATATCTTCTGTGACAGATCCATAGATCCAACCAATCTCAGTTCCCCATTCAGACTTGTCCTCA
TAGCCACAACTTATGACATGGATAGCTTCTTTCAGAAGAGATTCTGGAGTGGAGGACTGAGGAACACCACCATATTCCATCAGAGTGGAGGCAACAAATG
CTGCTGACTGGCCAAATCTCTTCTCTAAGCTCATTTGAGACATGAGAACTGATTTCTCATCATCAAACCCAGCACCTTCAACACCCTCCTCTATGTCTTC
GAGAT
page-top