Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1742
Contig Information
Length 542 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc10e13    whpc3n12    rwhpc10e13    rwhpc3n12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 426
Evalue 1.65488e-40
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1742
CCTCGTGCCGCGACCAGACGAACACGAGCACGAAGGCGATGGCGACTGCTCTCAACCGCGGCCTCCGCTCCGGGATCCGCCTCCTCGCCACCGGCGCCGA
GGCCTCCAAGCCAGCTTCACGTGGATTCCATGCTACCGGCGTGAAGAGGATGTCAGGGCACGGCCATGATGAGCCATACTACCTCCACGCCAAGCACATG
TACAACTTGCACAGGATGAAGCATCAGAAGCTGACTGCATGGACTTCAGTGCTGGGAGCCGTAAGCATTGGTGTCGGTGTCCCGGTCTTCGCGGTCATCT
TCCAGCAAAAGAAAGCCTCCGGATGAGCTCACATACCCTCCCAGGGCCTACTTATTGGACCTATTTTGAATTTAGCATTTTGTGAAGCCAAAGCTGTCAC
TTCACTTGACTCTTGTTGTTTCGTGTTACTCCATTTGCTGTTAGCAGATGATCTGAATCTGTAAGCTCGTTTCTTTACGGCACTGCTTTTCTGTTAATAA
TACAAGTGGCTTGAACTTTCCAGGCTGTGGAGAAAAAAAAAA
page-top