Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1670
Contig Information
Length 450 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc5g05    whpc5g06    rwhpc5g05    rwhpc5g06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 305
Evalue 1.29518e-26
Total Hit Count 290
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1670
TTTTTTTTTTAAAAAAAGAGATAAAAACCTTATCATATAAGATTGACTTGGGGTGCAGAGGGGTAGAGAGTGAGAGACGTGTCACAAAAATACAAATAGG
TTGGCATAACGCATAACAGGCAGCTGTAGGGACATACTTTCAAGTTTCAAAGATCCTAAAATCAGAACCAAAATTACTAACAGATATCCATCGCTCGATA
GCCAAAATACAGAGATTGTTAAGTCTTCACTCCACTACAGAACCCCTGGATTCCTCAAGACAACAGTAGGGCAATCATGCTTCGGTCTGCTCCCTCAAGC
GACGGATCGTGCTCCTGACGGTGACTGCACTAGCAGTGTTCATGGTATAGGCGCCGCCAGCCTTGACCTTGCCACAGTCCTTGCATCCCCAAATTCCAAC
AGCTTTCCTCTTCACAGCAAACTTCCCACAGAATTCACAGAAGTACTTGG
page-top