Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1633
Contig Information
Length 1021 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc8p16    whpc14g07    rwhpc8p16    rwhpc14g07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cation transport protein chaC [Zea mays] >gi|195630483|gb|ACG36635.1| cation transport protein chaC [Zea mays]
Score 994
Evalue 8.25037e-106
Total Hit Count 441
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1633
CCCCATCCGTCCGTCCGTCCCGGGGAGGAGAGGAGACGCGGGCGAGGCAAGAGGAGAGTCAAATCCCCATCTTGCTCCCCCCCCCGCGCCGCCGACCCCA
CCCGCGGCATTCTCTCCGGCGTCCCTCCTCCGGCCAGGGGGAAAAGCAGCAGCAGGATGGTGCTGTGGGTCTTCGGGTATGGGTCCCTGATCTGGAACCC
CGGATTCGACTTCGACGAGAAGATCCTGGGATTCATCAAGGGATACAAGCGAACGTTTAATCTTGCTTGCATTGACCATAGAGGCACACCACAGCATCCG
GCCAGGACCTGCACCCTTGAATCCGAAGATGAAGCCATATGCTGGGGAATTGCTTATTGTGTCAAAGGTGGTCTAGAAAAAGAGCGAGAAGCAATGCAGT
ACTTGGAGAGAAGAGAATGCGAGTATGACCAGAAGATCTCTGTGGATTTCTACAAGGATGGAAATTCTCTGGAACCAGCTGTGACGGATGTATTAGTTTT
CGTATCCACTCCTGATCCAGTTGGCAACAAATACTATCTTGGCCCTGCTGCTTTGGAGGATATGGCAAGGCAAATTGCTACAGCCAGTGGCCCTAATGGA
TATAATAGGGACTACCTGTTCTCAATGGAGAAGGCACTGTCCAATATAAGCCATGAAGACGACTCGATCATTGTGCTTGCGGATGAGGTGAGGAAGGTGC
TGAGCAGGTCGACGGAGAAGAAGGTTACCGGCTCCGACATACCATTAAAATCGCATACACCTGTTGTGCACATCTCTGCTCTTCCTGAGGGCACCGTTGC
GGTTTCAACATAGTAAGAAGAGCAGCACGGATGGATCAGCGAAAGAGATGGCATTTTCCTCTGACCACACATACTCTTTGACATTCTCCCATTGAAAGAT
CTGCGGTTTACTTCAGCTCTGGCACCATTGAGGGTGTGCGCTAATTTTCTTTGGCAACTATTGTGGCAAAGGCTGTAGCTTCCAGAGTGCTAATGCGAAA
GCCTGAGACTTGAAGTGTTAT
page-top