Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig32
Contig Information
Length 530 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 2 Clones [Download: CSV  ,  FASTA ]
whfl53l01    whfl53l02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 452
Evalue 2.07962e-61
Total Hit Count 408
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig32
gcCTACCTTGTGCGCTTTACTGCTCCATTTACTCCCGCAGAGAGAGAAGGGAGATAATGGCCGCCGGCGAGAGAAACGAGTCTTCGGCGGCGGCGGCGGC
GCCATTGCTGGCAGCAGCGAGGGAGAGGAAGCTCTGCAAGGAGGGGTGCCCAGGGTGCAGGCTGGACGAGATCAACAAGAGCAAGACCGGCATCCCCTAC
CTCAACTTCTTCTACGTGTGGGTCGTCTGTCTCTGCGCCGCTCTACCGATCCAGTCACTGTTTCCCTATCTATACTTCATGATTAGGGACTTGGAAGTCG
CAAAGCAAGAGCAAGACATTGGGTTCTATGCTGGTTTTGTTGGGGCTGCTTATTTCCTTGGAAGAACCATCAGTGCTGTGCCATGGGGCATTTTTGCTGA
CAAATAtggggagGAAGCCTTGCATTGTTAtcagtatcctctcagtgatcgtatttaacacccttttcggccttagcacgacttactggatggcaattgt
aactanggggctacttgggttactctgtgg
page-top