Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1575
Contig Information
Length 770 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc10f21    whpc19o13    rwhpc10f21    rwhpc19o13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays] >gi|195653093|gb|ACG46014.1| ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 448
Evalue 1.03906e-42
Total Hit Count 126
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1575
TCCTCCTCCCCCAAATCACAAACACCGAAGAAGAGAGGAGACGAGAAAGGGGATCGCCGCCGCCGCCGCCGCCGTCGCCCAGGATGACGTCGATGCTGTC
CGCGTTCTCGTCGTGGTTCGTGAACCCGCGCCGCAACCCGCTGGCCCGCATCCACATGCTCACCATCTCCAACCGCCTCAAGAACTACGGCCTGAGGTAC
GACGACCTGTATGACCCCTACTTCGATCTGGACATCAAGGAGGCGCTCTGCAGGCTGCCCCGGGAGGTGGTCGACGCCCGCCACCAGCGTCTCAAGCGCG
CCATGGACCTCTCCATGAAGCACCAGTACCTCCCCGACGACGTCCGGGCACTACAGACACCATTCAAAAGCTATTTGAGCGACATGCTGGCTCTGGTGAA
AAAGGAGGCAGCAGAGCGTAAAGCACTGGGAGCCCTTCCTCTCTATGAGAGAACCCTTCCTTGAAGACATCTTCCTTGATATGCGCCACAGCTTTTGCTC
CTTGTAGCATCACAATGCATGAAATAAAATGCAGATTATGACACTGTTCCTCCTTCGGGTTTCATGTCCATTGCCTGTAGCAGTTTCTTGTGCCCCTTCC
CAAATTAATTGCGACAGAATTTCTGTTGCTGTTGCTGATATAAAAGTTTATTTTGGTTGATGGAATTGTTGCTATAGAAGTCTGAACAACTCTGCTCTTG
GTCTTTTTTCCATTGAGCAACGTTTTTGTTGCTTGCTTCTGGGTTTACGCTGCCCATTTCAAAAAAAAAA
page-top