Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1573
Contig Information
Length 575 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc10d13    whpc10h10    rwhpc10d13    rwhpc10h10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cystatin WC-1 [Triticum aestivum] >gi|82503157|gb|ABB80380.1| cystatin WC-1 [Triticum aestivum]
Score 627
Evalue 9.62224e-64
Total Hit Count 320
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1573
GGGATCGGTTGCTGCCCTCCTCTTGCTACTCGCCATCGTCGTGCCGTTTACTCAGACCCAGACGCAGAGCGCACGGGACAAAGCTGCCATGGCGGAAGAC
GCGGGGCCGCTGGTGGGAGGCATCAGTGACTCGCCGATGGGGCAAGAAAACGACCTCGACGTCATCGCGCTCGCCCGCTTCGCCGTCTCCGAGCACAACA
ACAAGGCCAATGCCCTGCTGGAGTTCGAGAATGTGGTGAAGGTGAAGAAGCAAACTGTTGCTGGCACGATGCACTACATTACAATCCGGGTCACTGAAGG
TGGGGCCAAGAAGCTCTATGAAGCTAAGGTGTGGGAGAAACCATGGGAGAACTTTAAGAAGCTCGAGGAGTTCAAGCTGGTGGAGGACGTTCCAAGCGCA
TAACTCATAAGGCGCGTCCCAGCTTTGCAAGGATCTGCAGCTATGGTGTTGATGTAGCTATCTATCGGACATGGTTTAGCGTGTTCTCGTGTAATATCAA
GAATAAGTCCGCTTCTTGCAAGTTGTTTTAACCACATCTCTAAATAAAATTCTCAGTATTATTGTAAAAAAAAAA
page-top