Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1570
Contig Information
Length 690 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc10c18    whpc12d01    rwhpc10c18    rwhpc12d01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ZIM motif-containing protein [Triticum aestivum]
Score 578
Evalue 7.05614e-58
Total Hit Count 182
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1570
AGAGGAAGGAGCAGGAGCAGGAGCAGGAGCACAAGGAGCAGGAGACCCAGCAGCCAGGGCTCACCGGCCGACCCCCGCTCGCCAACGGCAGGTCTGGAAT
GTTGCGAATGTCGAGCCCTCCAGCAAATCCGGGACAGCTTACCATTTTTTATGGTGGGTCAGTATGTGTGTATGACTCAGTGCCACCAGAGAAGGCTCAA
GCAATCATGCTCATTGCAGCAGCAGCAGCTGCGGCCTCAAAAAGCAATGGCACCACTGCTGTTAAGCCTCCAGCGATGTCTGCGACCAATGCTATCCAAG
CCATGCTTACGCGGTCGCTCTCACTCCAGAGCACTTCTGTAGCAAATGGACAACCTCAGGCTGTCGCGGATCCTGGCTCGATTTGCAAGCTTCAGGCTGA
TCTTCCCATCGCCAGGAGACACTCCCTTCAGCGCTTCCTGGAGAAGCGCCGTGACAGGTTAGCATGAATGAAGAGTACAAGTAGCAGTCTACGTTCTTCT
GGAGCGTATTATGAGTATTATGACCCCCTTACATTTGTTGTTTTGTGTTTCCACATGCTGTGTATGGTGTACCACAGCATTTAGAAATGCATTTGTATGA
GGCCAAGTCTTCAAAACCAAGTCTTGTACTTCTGTGCCCCGTTCATGATCAATCCAAATTATGATAACCGTTCTATTTTCAAAAAAAAAA
page-top