Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1568
Contig Information
Length 784 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc10a12    whpc9b24    rwhpc10a12    rwhpc9b24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_015493 [Oryza sativa (japonica cultivar-group)]
Score 1101
Evalue 2.06126e-118
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1568
CATTGGTCTCGCTGCACTCCGATGAATTTTCCTCGCTGTCTGTTTGCCTCAGGAAGTTCTGGTGAGATTGCCATTGTTGCTGGTGGGTGTGATAGGAACG
GGCAGGTGCTGAGATCTGCGGAGCTGTACAATTCAGAGGCTGGCCAGTGGGAGACCTTGCCAGACATGAACTTGCCCAGGAGACTCTCCTCAGGTTTCTT
CATGGATGGCAAGTTCTATGTCATCGGGGGTGTGACGAGTGAGAGGCATTCTCTGACTTGTGGAGAGGAATACGATCTCGACACCAGGACATGGAGAAGA
ATACAGGACATGTACCCCGGAGGAACCAGCGCCTCCCAGTCGCCTCCGCTCATCGCCGTTGTAAATAACCAGCTCTACGCGGCTGACCAGTCCACAAACG
TGGTGAAGAAGTACGACAAGGCAAGCAACACATGGAACATAGTGAAGCCCTTGCCCGTCAGAGCGGACTCTTCCAACGGCTGGGGCCTGGCTTTCAAGGG
ATGCGGCGATAGACTGCTGGTCATCGGCGGCCACAGAGGACCTCGCGGCGAGGTGATACTGCTGCATTCCTGGTGCCCGGAAGATGGGAACGGCGCCGCC
TCCGACTCCGACTGGGAGGTGCTCTCGGTGAAGGAGCGCGCCGGCGTCTTCGTCTACAACTGTGCAATAACGGGGTGCTGAGTTAGCAGCACCTTGGCTT
CAGTACATGCCACCACTTGTTTAGCAAAACCCACCGATTCGTTGCTGCCATTTTAGCTGCTGCTACTTCTTATAATGACTTGTA
page-top