Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1567
Contig Information
Length 740 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc10a02    whpc10a13    rwhpc10a02    rwhpc10a13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GH16976 [Drosophila grimshawi] >gi|193898762|gb|EDV97628.1| GH16976 [Drosophila grimshawi]
Score 84
Evalue 1.56377
Total Hit Count 69
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1567
CCTCGTGCCGTCTCTATTGGTATGAAGGCGTGGAGCGTGATTCTCTTGTTTTCAACTCGAGGCGATCAGGCCAGTAAACATGCTAAGCTTGCCTGGCTGG
CACACACGCTTAGGCACAACAATCGGCCCCGGCACCGCGCGCCAAGGCGCGCTGCAGCTTCTGGCTCTTTTGCTCCCAAGCTGGCCTCGCTTTCCTCGGT
GGTCAGCGGGAGAAGCATGAGGCGCTGCACCTCTGACCCCGTAGTGCTCAGCTCCAATTCATCAGGGAGGCCAGCGGCAAGCATCAAGTTTCCCTTGGTG
CTTCCTCATCAAGGAGGACGACTCGGGCAGCGCCGTCCTCAAGGTTGCTGTCACTCCTCGGCACTCCGCAGGATAGGCACATCCGCCACCACACCGCAGA
ACAGACGAGGATGTGATGCTCCTCCTTCTTGTGGTGTATGTGTTGGCGTGGCTTGCCGTAGTGAGGCATATCCTCGTGGGCAATGCTATTTGAAGACCAT
TCAAGTGATTTAAAAGAGAAAATGTCCAGAATGTAAGGAAGTTGAAGATGACGATCAAAAGATTGACATATTAAGCGACTGCCAAGATGCCAATAATGCT
TGCCCCTGCCATTAGTAATACCCTTGCTCTTCTTTATGAAATCTTTCCTATTATATATTGATGCATCAACTATCGGTGCAGATTGCGAGATCCCTATTTA
AATGCATCACTCAGTGGCTGGCCCGTGCATAAAAAAAAAA
page-top