Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1564
Contig Information
Length 855 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
rwhpc10p22    rwhpc4d24    rwhpc9e07    rwhpc20l19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit vacuolar proton-inorganic pyrophosphatase [Hordeum vulgare]
Score 766
Evalue 2.33204e-87
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1564
TTGTTCAGGGTTCAACATTATCGTCGTCATCACGGGACGAGGAAAATTTGCCAGACACATACCAATAATGACCGAGGACATCTGGTCTCTCTCTTCTACT
ACATGGAGCTACAAGCCGGTAGGTAATGGTGAGACTAACGTAACACACCCAAGAGGCCAAAGGGAAAGTGGGGGGTAAACTGCGGCAATCCTGGAATAAT
GACACAAGAACCAAAAATAACAGCAGCGCACAACATACGAACGGCGGGCGGGCGGGGCAGAGTTATTCNTGATGGTGATGGTGTCCGTAGATTCTAAGTC
CGCTCGACTCGTCGTGAGTCTTCTAGATGTACTTGAACAGCACACCTCCGTACGTGGCGAAGAAGGGCGCGAACACGAGGGACTCGACGGCCATGTAGCT
TGATGAGGATGTTGAGCGACGGGCCTGAGGTGTCCTTGAGGGGGTCTCCGATGGTGTCGCCGATCACGGCCGCCTTGTGGCAGTCTGAACCCTTGGGGCC
AAGGGACCTCGCGTGCTCGCTGTTGCCGGCCTCAATGTACTTCTTTGCGTTGTCCCATGCACCGCCGGTGTTGGAAGCAGAGATGGCGATCTGTACTCCA
GAAACAAGGGCACCAGCAAGAACACCAGACAGGGTTTCCACGCCAAAGAGGGTTCCGACAATGAGGGGGGTGAGCATGACCAAAGCACCCGGAGGAATCA
TCTCCCTGATGGAAGCATCAGTGGAGATCTTGACACAGGTGGCATAGTCGGGCTTGGCAGTTCCCTCCATCAGTCCAGGGATGGTATTGAACTGCCTGCG
GACCTCCTCAACCATCTTGAGAGCAGCACTTCCAACACTCTTCATGGTCATGGCA
page-top