Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1548
Contig Information
Length 1070 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc2i11    whpc6p20    rwhpc2i11    rwhpc6p20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit triosephosphat-isomerase [Triticum aestivum]
Score 1255
Evalue 4.79051e-136
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1548
TTTTTTTTTTAAACAGCAACAAGAGCTAAAGATTATTGCTGATATATGTTCAGTAGCAAACATTATCATTATTGGCTTGCAAGCTCAAGTCAGGGGGAGG
AAACACAGTAGCAGCTGCTCCACCACAAAATTACTAGCATAGTACACATAATAAACACAGGAGAGAAAAAAAGGAGTCTCTTCATCTTCGCTGTCTTACT
CCACGCCGAAAGGAGCCACGTCGAGATCTTGCTTAGGCAGACTTCACGGTGGCGGCGTTGATGATGTCGATGAACTCAGGCTTCAAGGAAGCTCCACCAA
CGAGGAAACCATCGACGTCGGGCTGCGCGGCCAACTCCTTGCAGCTTGCGCCAGTTACAGATCCTCCATAGATGATCCGCGTGGATTCAGCAACCTCGGG
GCTCACATTGGTCTTGAGCCAGTCCCTCAGATTGGCATGGACTTCCTGTGCCTGAGCCGGTGATGCAACTTTACCGGTGCCAATGGCCCACACTGGTTCA
TAGGCGACGACCACGTTGGTCCAGTCCTTGATCTTGTCAGCAATTGCTTTTGTCTGTTCAGCGACAACCGCCATGGTTGATCCAGCTTCTCGCTGCTCAA
GAGTCTCACCAACACATGCAATGACCTTCAAGCCCTGAGCGAGTGCATATGCAACCTTCTCTCCAACAAACTCGCTTGATTCTCCCATCAAGCTCCTCCT
TTCAGAGTGTCCAAGGATGACCCAGGGAACGCCGAGGTTGACAAGCATCTCAGCACTGACTTCACCGGTGAAAGCACCGCCCTTCTTCACCCAGCAGTTC
TGAGCAGCAACTTGGATCTCTGGGCGCAGCTTACCCTTGACGGTGGGAAGGAAGACATAGGGCGGGCTAACGACAACCTCGACAACATCCGTAGAGGCGA
TCTGTCCAGCGTTCAGAGTATTGACGATGCTCTCTACCTGTTCGACAGTTCCATTGCATTTCCAGTTGCCGCCGACGAAGAACTTGCGGCCCATGGCGAC
GGAGGAGGAGGGGGGAGATCGGATCGGGTTGGGACGGGCGGACGGGAGAGGGGGGCTCGAGATTGGATTT
page-top