Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1522
Contig Information
Length 1452 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc13g01    rwhpc10h16    rwhpc13g01    rwhpc15e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1823
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1522
ATCGTGGCCCATTTAACCCACGAATGTTCCAACTCGCACTGGAATAACTCCGACCACCCGGAGCGAAACAATAACCATCACAACCTCAAGTCTCAGATGA
CAGACACGACATAATAATACTGTAACTAGCAGCAGGCTTCACCGCCTCTGTCACAGAACATCGACTGTTTAGTCAACCTCCTCGATCTTGGGGCCAGGGC
CGCCGGACGCAGCTGGGGTATCGTCGTCCATGCCGCCCTCCATGTCAGCACCAGCACCCTGGTACATCTTGGCGATGATGGGGTTGCACAGGGCCTCCAG
CTCCTTCATCTTGTCCTCGAACTCGTCCGCCTCAGCAAGCTGGTTCGTGTCCAGCCACTGGATGGCAGCATCAATGGCATCCTCGATCTTCTTCTTGTCG
TCCGCCGGCAGCTTGGAGGCGACCTTCTCGTCCTTGATCGTGTTGCGCATGTTGTATGAGTAGTTCTCCAGGGCGTTCTTGGACTCCACCTTCTTCTTGT
GTTCCTCGTCCTCGGACTTGTACTTCTCAGCCTCCTGGACCATCTTCTCGATCTCCTCCTTGCTCAGCCTGCCCTTGTCGTTGGTGATGGTGATCTTGTT
CTTCTGCCCAGTCGTCTTGTCCTCAGCAGACACGTTCAGGATACCATTGGCATCGATGTCAAAGCAGACCGTGATCTGGGGAACTCCCCTGGGTGCGGGA
GGGATGCCAGACAGCTCGAACTTGCCAAGGAGGTTGTTGTCACGGGTCCTTGTCCTCTCACCCTCATACACCTGGATGAGCACACCGGGCTGGTTGTCCG
AGTAGGTGGAGAAGACCTGCTCCTTCTTGGTGGGGATGGTGGTGTTCCTTGGAATCAAAACTGTCATCACACCCCCAGCTGTCTCCAGACCAAGAGAAAG
AGGAGTGACATCCAATAACAGCAGGTCCTGGACCTTCTCGTTGCCCTCTCCGCTCAAGATGGCAGCCTGGACAGCAGCCCCGTACGCAACAGCCTCATCA
GGGTTGATGCTCTTGCACAGCTCCTTGCCGTTGAAGAAGTCCTGGAGAAGCTGCTGCACTTTGGGAATCCTAGTGGAACCACCAACAAGGACAACATCGT
GCACGGTGCTCTTGTCCATCTTTGCATCCCTGAGACACTTCTCCACAGGCTCCATACACTTCCTGAACAGATCCATGTTCATCTCCTCAAACCTGGCCCG
GGTGATGGTGGAGTAGAAGTCAATGCCCTCAAACAGCGAGTCAATCTCAATGGTGGTCTGTGCAGTGGAGGAGAGAGTCCTCTTTGCCCTCTCACAGGAT
GTCCTCAGCCTCCGAAGAGCTCTCGGGTTGCCACTGATGTCCTTCTTGTTCTTCCTCTTGAACTCCTGGACGAAGTGGTTGACCATCCTGTTATCAAAGT
CCTCACCACCAAGATGAGTGTCACCAGCTGTGGCTTTAACCTCAAAGATGCC
page-top