Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1497
Contig Information
Length 1808 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc15n03    whpc17a12    rwhpc15n03    rwhpc17a12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0832800 [Oryza sativa (japonica cultivar-group)] >gi|20372917|emb|CAD30022.1| N-acetylglucosaminyltransferase 1 [Oryza sativa] >gi|48716410|dbj|BAD23019.1| N-acetylglucosaminyltransferase I-like protein [Oryza sativa Japonica Group] >gi|50251412|dbj|BAD28450.1| N-acetylglucosaminyltransferase I-like protein [Oryza sativa Japonica Group] >gi|113538162|dbj|BAF10545.1| Os02g0832800 [Oryza sativa (japonica cultivar-group)] >gi|215715352|dbj|BAG95103.1| unnamed protein product [Oryza sativa Japonica Group]
Score 992
Evalue 0
Total Hit Count 218
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1497
CCGTGGAGTCTCCCTCCCTCCCAAGTCAGTCAGACAGACAGGGGGCGACTGCTCTGCCTGCAAAGGAGTCGTCTTTCTTCCCCTGCTCCGCCGCCGGCGC
CGGCGATGGCGCGCAACCCCTGCGACATCCGCCTCCTCCTCGTGGCCGCCGCCTTCGCCTTCATCTACATCCAAGTGCGGCTCTTCTCCACCCAGTCTTC
TTCTTCTTCTAATTCCCACTCTTCAGACGCCGGACGCCTCGCGGAAGCAGAGAAATGCGAGAGCCAGCTGCACGCCATGATCGACCAGGTCAGCGCCCAG
CAGGAGAAGATCGCCGCACTTGAAGAGATGAAGGTACGCCAAGACGAGGAGCGCGTGCAGCTCAAGATTTTAATCCAAGATCTTGAAAAGAGGAGTTTAC
AGACCTTAACAAACAAGAACGTGGTTCCTGTCGCCGCTGTTGTCATAATGGCTTGCAATCGACCAGACTATTTGCAGAGGACAGTCGAATCTATCCTCAA
GTATCAGAAAGCAGTTGCTTCAAAGTTCCCACTGTTTATATCACAGGATGGAACAAATGGAGAAGTAAAAAAGAAAGCTTTGAGTTACACTCAAATAACA
TTTATGCAGCATGTGGATCTTGAGCCTGTGCGCACTGAAAGACCAGGAGAAAACGTTGCATATTACAAGATAGCTAACCACTATAAATGGGCCTTGGATG
AGCTATTCATTAAGCATGATTTTCGTCGAGTAATCATTCTGGAAGATGACATGGAGATCGCCCCAGATTTCTTTGAGTACTTCGAGGCTGCAGCGAAAAT
TGCTTGACACTGACAAGTCGATAATGGCTGTTTCATCTTGGAATGACAATGGGGCAAAAGCAGTTTGTTTATGACCCAAAGGCTCTTTACCGTTCGGACT
TCTTTCCTGGGCTTGGATGGATGCTAACAAAGTCAACATGGATGGAGCTGTCACCAAAGTGGCCCAAAGCTTATTGGGATGACTGGGTGAGGCTAAAGGA
GGTACACAGAGATCGGCAGTTTATTCGGCCAGAAGTATGCAGAACATACAACTTTGGCGAGCATGGATCAAGCATGGGACAATTCTTTGATCAATACTTG
AAACCAATCAAGTTAAATGATGCTCATATTGACTGGAATTCCGAGGACCTGAGCTACCTCAAGGAGGACAAGTTTCTGACCAAATTTGGAAAAGACGTGG
CTAGCGCCACACCTGTGCATGGATCCGATGCTCTGTTGAAGGCTCACAATCTGGATGTGGACGTAAGGATTCAGTATGACAATCAGGGCGACTTCGAGCG
TATAGCTCGTCAGTTTGGAATATTTGAAGAGTGGAAGGACGGTGTCCCACGGGCGGCTTACAAAGGCGTGGTGGTGTTCCGGTACAAGAGCAGCCGAAGA
CGGATATACCTGGTGGGCCCCGACTCTCTTGGCCAACTCGGGGTTTAGCTTAGCGTTGCCAAGGTGGGGAAATCTGTCGACGACGTGGGGAAGTTGACGC
CCTGATGTAGCAAAACATTGAATGACGGGTGCAAATTGAATGCACAGTTGCCAAGGATATTTTTTCCTTTTATGATGGATGGACGACGGGTGTTTATTTC
GCCCTCGAGCCGAGGTCTCGAGGGGTTTCGCCGTCCGTCGACAGTCGAGGAGGGGATAGAGTAGAGTAAGAGAGTAAGGGAAGAAGAGCGCGCGGTGTAG
AGATGTATTCACAGAGGTACATTATTTGGCTGGGATTCATTCATCCATGTGTGTGTTGTAGTTAGTAAAAGAGTTTGTATTCAAGTTTGCGTCTGTGTGT
TTACTACT
page-top