Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1473
Contig Information
Length 2030 bp
Tissue Anther at meiosis
Clones 4 Clones [Download: CSV  ,  FASTA ]
whpc11f08    whpc3o12    rwhpc11f08    rwhpc3o12   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_28114 [Oryza sativa Indica Group]
Score 492
Evalue 1.70708e-62
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1473
AAGGGACACTGGTTTGTTTGGTACTAATGATTGGCTATTTTATAGGAGATGCCTGACCACTTCTAGTCTTGGATACTTGGATAGAGGAAGTATTAAAAAA
CACTAGGTGTTAACATATATAGTAGAATTCTGGCATTACAACATATAGCGGCAAGAAAATACTACAGACAAATGATACTAGGTCCACTAGGACAATGGGA
AACACGGGGATACAGTCGTCTAGACACGCGGCAGTTGCATCAGACCATTTTGTGGCTCAAACAGTTTCTAATCGTCACCAAACGTGGTCTTCTTCCCGGC
GCTAGCTGTGCCAGCACTCTGTCTGCTCTGAAAGCCTCGGCCGCCTCCTCTGCCGCCATCACGGCCACCAGACCGGCCAAACCTGCCGCCACCATCACGG
CCACCAGACCGGCCAAACCTGCCACCGCCATCACGACCACCAGACCGGCCGAACCTGCCACCGCCAGAGCGGCCACCATCTCTGCCACCAGATCGACCAC
CAACGCCACCAAATTGACCCTTAGGCTTAGCTTCAGCAACATACAAGTTGCAGCCACCTAGGTCAGATCCACTAAGCGCAAGTGCTTTCGAAAAGGAACT
CTCATCAGTAAAATCCATGTAAGCTATCCCTTTGCTTGCACCATTCTCATAATCCATCGGAACTGAGACACGTGTGATTTCTCCACATTTAGAGAAGTGT
TCTTGAAGAGAGCTCCGAATAGCATCCTCCTGTTGAGATGAATCAAAACCCTTGACAAATACTGAGAGGCTGGGACCTCCACTTGGTTTTCCAAACGATC
CACCATCCCTGGTGCGAGGAGTTGCACCTCTTTCAGCAGCCATGTCAAGTCTCACCGGACGGCCCATTAGATCTCCACCATTCAGTGAATCAAGCGCTTT
CTGAGCATCTTCAGCCGTAGCAAACTCAACATGACCAAATCCCTTGGGATGGCCATCTTCATGGGTAGCCAGGCGAACATCAACGAACCTCTCCAATTTG
TGCAAAAAATTGCTTCACTTGATCATACTCAATATTGAAGGAAAGGTTCCCCATCCAAAGGGTCTTCGACCCTGTTGCCTGACCTTTGTTGCTAGCAGGA
GTTTTAGGCTCTTCCTTCTGTGATTTTGAGGCAGTTGTAACTTTCTTTTTAGGCTCATCATCAGAGCTTTCATCAGAACTGTCATCATCACTGGTGCTGT
CCTTTTTGGCAGACTTAGGAGTAACCTTCGCAGCATCCTTCAGCTTTTTCTGGGGAGGCTCTTCATCACTCTCATCACTGTCTGAGGAATCACTGGGCTC
CTCCTTTCTTTTAGCAGCTGCAGGAGCTATCTTGGTGGCCTGTGCGGCTTTCTTTGACTTCTCCTCATCCTCAGATTCACTCTCCGACTCAGAACTGTCT
GAAGAATCTACCTTCTTGGCAGCAGCAGCAGGAGTCTTGGCAGGAACATCCTCATCTGAGCTATCATCTGAGTCACTCTCGGAGCTGTCAGATTCGATGA
CTGGTGTTCTCTTTACCAGAGCAGCAGGTTTCTCGTCATCATCGGACTCATCCTCAGAACTGGAAGAGCTGCTCTCAGGCTTGCCTTTCTTCGAGCCGTT
GCTGGCAGCTGGGGTCACAGGTTTAGCAGAAGGCTTCTTTGCAGGTTCCTCGTCAAAGGAGGAATCGTCGCTGCTATCATCTGAAGACTCGTGTTTGACA
GGCTTTGCAGTCTTCTTAGGAACCTCCTCCTCCTCGGACTCGGATGACTCCTCCTCGGAGCTGCTGCTCTCAACCTTCTTGGGCGGCGGCTGCTTCTTGG
CCTTCTTGGCGGCCTCTTTGGGCCCGGGCACCGCCTTTGCCGGCGCAGCCTTCTGTTTCTTTGCGCTTACAGCCTTCTCGATCTCGTCATCGGCTTCGCG
CTTCTTCCCGGCCTTCCCCTTGGTAAGGACGGCCGCCGGCGCCACGACAGTAGGGGCCGCGGACTTCTTGCTTGACTTGCCCATGGACCGCTGGCGGCGT
AGAGGCAAGGAGGGAGTGTAGGGGAGCGAG
page-top