Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1392
Contig Information
Length 1181 bp
Tissue Anther at meiosis
Clones 3 Clones [Download: CSV  ,  FASTA ]
whpc10p22    whpc4d24    whpc9e07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Pyrophosphate-energized vacuolar membrane proton pump; AltName: Full=Pyrophosphate-energized inorganic pyrophosphatase; Short=H(+)-PPase >gi|6012172|dbj|BAA02717.2| inorganic pyrophosphatase [Hordeum vulgare subsp. vulgare]
Score 1845
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1392
AGGGTGTTGGGAAGGCATTTATCACCGCTTTCCGCTCTGGTGCAGTCATGGGCTTCTTGTTGTCATCAAGTGGGCTTGTGGTTCTTTACATCACCATCAA
TGTGTTCAAGATGTACTACGGTGATGACTGGGAAGGTCTTTTTGAGTCCATCACTGGTTATGGTCTGGGTGGGTCTTCCATGGCTCTATTCGGAAGAGTT
GGTGGAGGTATCTACACCAAGGCTGCTGACGTGGGTGCTGACCTTGTTGGCAAAGTTGAGAGGAACATTCCTGAAGATGACCCAAGGAACCCAGCTGTAA
TTGCTGACAACGTCGGTGACAATGTTGGTGATATTGCTGGGATGGGATCAGATCTCTTTGGTTCATACGCAGAATCGTCCTGCGCTGCTCTTGTTGTTGC
TTCTATCTCATCTTTTGGAATCAACCATGATTTCACTGCGATGTGCTACCCACTGCTCGTGAGCTCTGTTGGCATCATTGTTTGCTTGCTCACCACCCTG
TTTGCGACTGATTTCTTTGAGATCAAGGCTGCAAGCGAAATTGAACCTGCTCTGAAGAAGCAGCTCATCATCTCCACTGCTTTAATGACTATCGGTGTTG
CGGTGATCAGCTGGTTGGCTCTCCCAGCTAAGTTCACCATCTTCAACTTCGGTGCTCAGAAGGACGTGTCCAACTGGGGCCTGTTCTTCTGTGTGGCAGT
TGGTCTGTGGGCTGGTCTGATTATTGGGTTTGTGACCGAATACTACACTAGCAATGCCTACAGCCCTGTGCAAGATGTTGCCGATTCCTGCAGAACTGGT
GCTGCCACCAACGTCATCTTCGGTCTTGCCCTTGGTTACAAGTCAGTCATCATCCCAATTTTCGCTATTGCTGTCAGCATCTACGTCAGCTTCTCTATTG
CTGCAATGTACGGCATTGCAATGGCTGCTCTTGGCATGCTTAGCACAATGGCAACTGGTCTTGCTATCGATGCTTATGGTCCCATTAGTGACAATGCTGG
TGGAATTGCTGAGATGGCTGGCATGAGCCACAGAATCCGTGAGAGGACTGATGCTCTTGATGCTGCTGGCAACACAACCGCTGCTATTGGAAAGGGTTTC
GCCATTGGATCAGCTGCTCTTGTGTCCCTGGGCACTTTTCGGTGCTTTTGTCANCAAAAGCCGGCGTGAAAGGTCGTCGAT
page-top