Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1391
Contig Information
Length 823 bp
Tissue Anther at meiosis
Clones 3 Clones [Download: CSV  ,  FASTA ]
whpc14b14    rwhpc14b14    rwhpc18n14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 858
Evalue 3.35027e-90
Total Hit Count 150
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1391
TTTTTTTTTTCCAAACAGAATGACAAACTTGGATTACCCAAAGCAGCTCATACATTAAGAAACATTCATCCTTTTCTACCAGTGTTGCCAGAGTACATAG
GTGAAAAAGATAGCTCGCGGCTTCGTAATTAGTAGCGCTCGTAAATAATATCAATAATAATACAATTACAACGTATAACTGTCTGATCAGACGACAAGCT
AAAAACAAAACTTGCAGGGCCTAGTGGTGCTTGTTCAGATCAATTCTTCAGTAGTTTCCTCAACACGTCTTCAGCATGACGCTCCATCTTTGGTAAAGCC
CAGTCATGCTGGATGATGTCGAGGCTGTCTTTCTCTGCGCTCAAGCTCATTGCTGGATTAAAGCCCATTCCACCACCCATCGCCATCATCTTTTGGGCAT
CATCAGTAGCTGCATAAACATTTTCTTCACCAAGGATGAGACTGAAAAGACCCCTCAAGCCAAATAAATTGAGGAAGTACCATGAACGGCTGCTAACATA
GCTCACATCAACAGTACTCAGGTCTATCCCATTTTGCAGCATTCCCCTGAATCGTTGAGTCAATGGAAAGGGGATTTTGGCTGCAACAAAACCGGAAAAG
AAGAAGTTCACCCATGCAAATGTAAGTGTCTGTGGAACTATCATGGAGAGATTCTTCTTCATCATATCCATGGCCATGTTTGGGTCCGAAAACATAGCCG
CCTGAGCCTTCTGGGCATCCTCTTTAGGAACATGAAGCAATCCTGCTTCCCCGTTGGTGTAATAAAGCTTGCGAGCCTTGAAGGCCTTGGCCGGGATGAA
CTGCGCGCCGTTCCTCAGGTTCC
page-top