Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1356
Contig Information
Length 881 bp
Tissue Anther at meiosis
Clones 3 Clones [Download: CSV  ,  FASTA ]
whpc10b21    rwhpc10b21    rwhpc4h09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pyruvate kinase-like [Deschampsia antarctica]
Score 1055
Evalue 5.43042e-113
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1356
TTTTGATATCATTATTCCATCAGATCATTTACTCGCTACACTGCAGTAAAATCTGAGGACATATCCATAATAACTAGCGTAGGTTTCAGAATGATAACCG
CGGATCCTATGATGACACCATAGGAAAAACTGCTCGTTTTGCAAAACTATAGATAGAATTATACATAGCCACCAAGCAACGGTTTTGGCCTAGTCAAAAA
TCTGGCAAGCCCTGTAGCAAAGGCTAATTTTGCCTAGTTCGTCTAGCTCAATGATCTTCACGACAGAGGAATCTCCCACTTTCTGGCACACGACGACACG
GTCATGCGACTTGATCACACCAGATGCTTTGCCGTGGTCAAGAGCAACCTTCAACACTGATTCATTTGTAGTGCTAGTAGATTCAGCCGGATGACGTGGA
TCAGCAAGCATGGGAAAGAGGCCTCTAACTATGAGTGATTGTCTTGCCTCAAATGCACCTGTGAAGCTCCACTTCAATTGATTTGTTTTCAGACGAGGAA
TGACAACGGACAGGACAGGCATGGTGGGCCTGTACTTGGCAATTAGCCTTGCAGCCCGTCCAGATGAAGTGAAGCAAATGATGACCGAAGCCTTAACTTT
AATAGCAGCCCGCACTGCAGAGGAAGCAATAGACTCCAAGTGGGTCATGGGTTCTCCCACATATTTCACGGTTCGCTTGAAATACAAATCTTGGTTGAAG
ACCTTCTCAGCCTCAGCACAAATTCTGCCCACTGTTGAAATAGTCTCGACTGGATACAACCCACGGAGAGTCTCAGCACCAAGGAGAATGGCATCACTAC
CGTCCAGCACCGCATTTGCCACATCAGTTGCCTCCGCACGAGTAGGCCTTAGGTTGTCCGTCATACTGTCCACAACACGAG
page-top