Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1346
Contig Information
Length 889 bp
Tissue Anther at meiosis
Clones 3 Clones [Download: CSV  ,  FASTA ]
whpc10d23    whpc11d18    whpc6f04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=UTP--glucose-1-phosphate uridylyltransferase; AltName: Full=UDP-glucose pyrophosphorylase; Short=UGPase; Short=UDPGP >gi|1212996|emb|CAA62689.1| UDP-glucose pyrophosphorylase [Hordeum vulgare subsp. vulgare]
Score 951
Evalue 7.87825e-121
Total Hit Count 285
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1346
CTCTCCCTTCAGTCATCTGACATCTGCTCCCGATCCTCTCCTCCTCTCCCCCCCGAAGCAGCGTGCGCGTCGCTCCTCTCCGCCCGGATCGCGATGGCCG
CCGCCGCCGTCGCCGCCGACTCCAAGATCGACAACCTCCGCGACGCCGTCGCCAAGCTCGGCGAGATCAGCGAGAACGAGAAGTCCGGGTTCATCAGCCT
CGTCTCGCGCTACCTCAGCGGCGAGGCGGAGCAGATCGAGTGGAGCAAGATCCAGACCCCCACCGATGAGGTGGTGGTGCCCTACGACACCCTCGCGCCC
CCTCCCGAAGATCTCGACGCCATGAAGGCCCTGCTCGACAAGCTCGTGGTGCTCAAGCTCAACGGAGGCCTCGGCACCACCATGGGCTGCACCGGCCCCA
AGTCTGTCATTGAAGTTCGCAATGGGTTTACATTTCTTGACCTTATTGTGATTCAGATTGAGTCCCTGAACAAGAAGTATGGATGCAGTGTTCCTTTGCT
TCTAATGAACTCTTTCAACACTCATGATGACACACAGAAGATTGTTGAGAAGTACTCCAACTCCAACATTGAAATTCACACTTTCAACCAGAGCCAATAC
CCTCGCATTGTTACTGAAGACTTCTTGCCACTTCCAAGCAAAGGGCAGACAGGGAAGGATGGCTGGTACCCCCCAGGCCACGGTGATGTGTTCCCCTCTT
TGAACAACAGTGGAAAACTCGATACCTTGCTGTCACAGGGAAAAGGAGTATGTCTTCGTGGCGAACTCAGACAACTTGGGTGCTATAGTTGACATCAAGA
TACTAAACCACCTGATCACTAACCAGAATGAGTACTGCATGGAAGTTACTCCAAAAACATTGGCTGATGTTAAANGGTGGGTACCCTCA
page-top