Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1077
Contig Information
Length 522 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10a07    rwhpc10a07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Cold-regulated protein BLT14 >gi|18938|emb|CAA40779.1| BLT14 protein [Hordeum vulgare subsp. vulgare] >gi|227753|prf||1710255A cold induced gene BLT14
Score 188
Evalue 5.85163e-13
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1077
AACACTATCTCCTCTGTAGTAGTACTACTATTACCAGAGCCGCCTCCCAGTTAGCAATGGCAAAGTGTCTCGCCGTCGCGCTCCTGCTGCTGGTGGTGCT
CGCGTCATGCGAAGGGAGGGAGCTGAATGAGAAGGTTGCAGCGACGCGTGGCGCAGGTGCGGGTGGTGGCGTCGGCGAGTCTAAGGCGTTGGACTTGCCT
TTGCTCGGGGGAACCGGTACGGGAACCAGCACCATTACCGGCCCGCTGGTGGTGCTTCCTGGGATCCCTGCTATTGGCCCATGATCATCTCTGGCTCATG
TGCTGGCTTACAAGGAGCTAAAGCTCGCCTTGTCGCTTTAGATTCTGTAGGTAGCACCGCCGGGAAGGAAAAAGCGGACGTTTTGCTCATTTCCATGTTC
GGTACTGAGCGCCTGTATCAACTGTCATCTGTACTATCTATTTCCAGTTCCATGTTCTCGTATTTTTCGTTCCTTGATGTGCTACATGTACCATCAATAA
ATAATAATTACTAAAAAAAAAA
page-top