Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig1045
Contig Information
Length 817 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10a11    rwhpc10a11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_029218 [Oryza sativa (japonica cultivar-group)]
Score 154
Evalue 1.42003e-08
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig1045
GCTTTGCGCAAAGTTCATTAGTTGTTTCTTTGTCTTCATAAGCTTGTTTTCTTACACTCTCCAACTCCCGGAGCATATGCTGGAATTTATTGTCAGCCTC
ATCAAATTCGTGAACAGTTTCCTGGGTGAGATAAGGTAAAACTTCATGTCATGTCAAGGTTTTCTTGAATGTTTAATATCTTCATCCTATTTCGTGTATT
TATCAAGCAAATTCTTCAGCATGGACCACATTTGAAGTGCATATGCATTTCTGATTGCTTCATCAGTGACCATACAAAGTTTAAGTGTGGATGCATATTG
CTTACTGAAGATGTGGAGAATATAAATGAAGCAGCTTCTTTGTTCCTTGAAGTGTAACTGCTAAACTTTAAGTATGCCAAAATAAATATCATTTATATAA
TTGTGTTTACCTTTTCATTACCGTCGGATCGTCTGAGATTTGGTTTGTGCAGCCATGTATTTGAAACACACCACATCTCTGACAAGCTAGTTGATCTATC
CACTGAAAACTGTTGAGCACCAGGCTTTTGTGTACCTTGCGGCATTGCCCCATGGCTAAGGGGAACAGCCTTCCTAGTGTAGAGAGAATGCAGACAAGGA
GGGTAACATGTCAAATGCAGGCTGGAGTTCTGCAACGTAAGTGAAGAGTATCCGGCGCTCGACCAACCGTACTTACGTCAGCTCCTGCTCTTGCACCTGG
CTAGCAGGGATCCTGGCACCCACTGTGAACAACATTGGAGTACTAGCAGGTAATGAAACTACAAAGCTGCATAGAAGAACTTCTTTTTGAAATGGGGAAT
ATACTAATATCATGAAG
page-top