Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig980
Contig Information
Length 810 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10a20    rwhpc10a20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15463 [Oryza sativa Indica Group]
Score 609
Evalue 2.43047e-61
Total Hit Count 394
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig980
CAGAAAGATCCTTGATGGGGTTGAAGATGTGAAGATGAGGGCTGCAAAAGCTGGTGTCAAAGGAGTCGAACTACGGTTCCTCAACTCCCTTGGTGCCGAA
ATCTCTTTTCTGAGAGCAGAAAATAAAAGCCTTCACGACCAGCGGAAGGATACAGCTGAGGCTGTTCAAGCTGCTGGTGAATTGCTGGTACGACTGAAGG
AGGCCGAGGAAGCGACAACAGTTGCCCAGAACCGAGCCTTGTTGGCAGAGCAGGAGACGGAGAAAGCATATCAGGAGATAGACAACTTAAAGAAGAACTA
CGACCATGAAATCGTCGCGCTAAATCAACGCCTGACAGAGTACTCCAAGCACAACGATGCTACACCTCTGCCTGCCGCATCCAGCAATCTCGACTCTGCA
CCCAGATATGACTCGGTTGGTGGTAGCCCTGGCGATGATCAGCAATGGAGGGGGGAGTTGGACGCCATACACCAGCAGGGATCACTGGAGGTCACCAAGA
GCACTGACCTCAACTCGTGGTTCTCCGGATACGACAGATGCAACATCTGATGACGCCGTCACCGTTTATCTCTCCCTTGGGAGGAAAGGGTTAGTGGCAG
TAGTATGTTGTACACCTTGTAAGCATCAGATCAGAGGGCCAAGGACGCGTTTCTCTTCACCGACCGACCGTCCGTGTGTGGCGTTGTCATTGCAGATTCT
TCAAGTGTACTATTATTCTCCCTTGTATATTACGATGGACAGCGGCGCTCTACATTACAAGAGCCAGGGCGATGCCCTTCTCAATCTTTTACCAATGAGC
AAAAAAAAAA
page-top