Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig969
Contig Information
Length 622 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc18f06    rwhpc18f06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 449
Evalue 5.01014e-43
Total Hit Count 128
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig969
GGGGATCGCCGCCGCCGCCGCCGCCGCCGCCCAGGATGACGTCGATGCTGTCCGCGTTCTCGTCGTGGTTCGTGAACCCGCGCCGCAACCCGCTGGCCCG
CATCCACATGCTCACCATCTCCAACCGCCTCAAGAACTTCGGCCTGAGGTACGACGATCTGTACGACCCCTACTTCGATCTGGACATCAAGGAGGCGCTC
GGCAGGCTGCCCCGGGAGGTGGTCGACGCCCGCCACCAGCGCCTCAAGCGCGCCATGGACCTCTCCATGAAGCACCAGTACCTCCCCGACGACGTCCGGG
CACTGCAGACACCATTCAAAAGCTATTTGAGCGACATGCTGGCTCTGGTGAAAAAGGAGGCAGCAGAGCGTAAAGCACTGGGAGCCCTTCCCCTCTACGA
GAGAACCCTTCCTTGAAGACTTCTTTTCATGATATGCGCCACAATTTTTGCTCCTCGTAGCATCATAATGCATGAAATAAAATGCAGATTATGACACTAT
TCCTACTTCCGGTTTCATGTCCATTGCCTGTAGCAGTTTCTCGTGCCCATTCCCAAATTAATTGCGACAGAATTTCTGTTGCTGTTGCTGATATAAAAGT
TTATTTTGGTTGAAAAAAAAAA
page-top