Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig935
Contig Information
Length 928 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10a24    rwhpc10a24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit receptor expression-enhancing protein 6 [Zea mays] >gi|219887183|gb|ACL53966.1| unknown [Zea mays]
Score 768
Evalue 1.1377e-79
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig935
AGTTTGTGTGCGTGCCCTCCTCCTCTCGCGCCCGGAGCTCAGATCGCCGCGGATCCCTTGCCCTCCACGCAGCGGCCTCCCCCCTGGGTCCGCGCGCCGT
CTAGGGATCCCGGCTCCTCCTCCGCGGCGACCGATGGCTGCTCTTCTGGCGCCCGCCATCTCCGGCGAGGTCGGTTTGCGGCTTTTACTGGCACCACTAA
GCTCAAATATTGTCATACGCACAGCCAGTTGTGCGGTGGGCATTGGTCTGCCTGTATACTCCACTTACAGGGCTATAGAAAAGAAAGATCAAGATGAGAA
AGAACGGCTGCTCCTTTATTGGGCAGCATATGGATCTTTTAGCATTGTGGAATCCTTTGCTGATAAGCTTGTTTCAAGTGTTCCTCTGTATTACCATGCG
AAATTTGCTATCCTTATATGGCTCCAGTTTCCTTCAAATGGTGGATCAAAGCATGTGTACAGAAGATACCTGCGCCCGTTTTTCCGGAAGCATCAAGCAA
AAATTGATAGAATCCTGAATATCTTGTCCAAGGAACTTACGAAGTTTGTGAGCAACCATGAAGATGAAATTCGTTTTGTAGAGAACATGGCCATCAGGGG
TGCCACAACAGCAAATTACATCGTAAATGGGCTTGACCAACCTGGACAATCAGAAGAAGTTAGCGTGACTGAAGACCCAAATCCAACTCCGACAGAAGAG
CCAGACACACCTAGGAGTTGAAACTTGAGCCTGGTTGCCACACTTGCCAGTCTCCCCTCCAGATGTGTCTGGTGCTGCAGAAATGATCCTTTAGAACTGT
GAATATGTGTTTCTGAACAAGTCGGATTACGTTTCAAGCAGTAGGAGTGGATACTGTCCACTTGTATCAGAGTAGTACTCGTATTATGATGCTACAAAAG
TTGCAGCACAGGTTTGTGGGTGACTGTT
page-top