Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig919
Contig Information
Length 600 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10b08    rwhpc10b08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0607100 [Oryza sativa (japonica cultivar-group)] >gi|51091382|dbj|BAD36115.1| phosphatidic acid phosphatase-like [Oryza sativa Japonica Group] >gi|113596069|dbj|BAF19943.1| Os06g0607100 [Oryza sativa (japonica cultivar-group)] >gi|215700969|dbj|BAG92393.1| unnamed protein product [Oryza sativa Japonica Group]
Score 566
Evalue 1.25807e-56
Total Hit Count 109
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig919
CCTCGCCGAGCAGCGGCCGCGTGCCGCCATCGCCACGCTCATGATGTTCACCTGCCGTGGCCTGCTCGGGTGCTCCACGCAGCTGCCCCTGCCGGCGGAG
TTCCTGGGCTCCGGGATGGACTTCCCCGTGGGGAACGTGTCCTTTTTCCTCTTCTATTCTGGGCACGTCGCCGGAGCGGTGATCGCGTCCATCGACATGC
GCCGCGTGGGACGGCGCAGGCTGGCGGTGCTCTACGACACGCTCAACCTGCTGCAGTTCGTCAGGCTGCTTGCGTGCAGAGGGCATTACACCATTGACCT
GGCCGTCGGTGTCGGCGCTGGTCTCGTCTTCGACATGCTCGCCGGCTGGTACCTGGACAGCAAGAACATCGACAGCGGCGACAACCGTTGCTGCAGCAGC
TGCCAGAAGGCTCTCGTCTCACAGAAGCTTACATCATAGGGCTATCAATGGCCGTGGAATTGCAGTGGACTGGACGATCCAAGTCATTTTTTAGAATGCT
ACTTACTGATATGTAATTGTGTAACTGTGTTTGTCCTTTGTAAGTTAAGTTGCAACATCTTCTGAAATGCAAGTATCAGAAGCTTAAAGTAAAAAAAAAA
page-top