Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig788
Contig Information
Length 500 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc2b07    rwhpc2b07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DNA-directed RNA polymerases I, II, and III 14.4 kDa polypeptide [Zea mays]
Score 373
Evalue 1.81671e-34
Total Hit Count 221
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig788
ATCCTTGGCACACGTGCTTTGCAGATAAGCATGAATGCCCCAGTTATGGTTGAGCTTGAGGGTGAAACTGATCCTCTTGAGATTGCCATGAAAGAACTGA
GAGCACGTAAGATCCCCTTCACGATTAGGCGCTACTTACCTGATGGAAGCTACGAGGACTGGGGAGTTGACGAGCTCATTGTGGAGGACTCGTGGAAGCG
TCAGGTTGGCGGGGACTAGAGCTGGTAGACTGTTCGAATGGGAGGCTCCGTGCTGCAACTAAACTTTGCCCTAGTAGCTATATGCAATCTTTGGCACTGA
ACTGCCGCGACAATGTTATGTTACCGTAACATGTGTGGGCTATGTCTGCCCATTGTGTTGTGCTACTACTGTAAACCAATTGCGTGGTTGCGTTAGTTTG
CTTGGACCATTGCTTGCATGCAGCTACAAGTTGCGAATGAATACCCTACTCTAACCTCCTTTTGTGAGCGTGGTGCAGGACGTTCTGCTGAAAAAAAAAA
page-top