Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig740
Contig Information
Length 920 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10b14    rwhpc10b14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Unknown (protein for IMAGE:5194336) [Homo sapiens] >gi|111494016|gb|AAI11385.1| Unknown (protein for IMAGE:5198300) [Homo sapiens]
Score 1249
Evalue 1.87663e-135
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig740
CTCCCCTGCCTTAGCCGCGCAATGGCGACTACCACCATGTCCCTCTCCTCGGCCTTCGCCGGCAAGTCAGTGAAGAACGTGGCTTCATCAGCTCTCCTTG
GTGAGGCCCGAGTCACTATGCGCAAGACCGCTGCAAAGGGCCAAGCAGGTTTCATCAGGCAGCCCCATGGTACGGTGCCGACCCGTGTGCTCTACCTCGG
CCCGCTTTCCGGAGAGCCCCCGAGCTACTTGACCGGCGAGTTCCCCGGCGACTACGGGTGGGACACCGCCGGTCTCTCGGCCGACCCCGAGACCTTTGCC
AAGAACCGGGAGCTCGAGGTGATCCACTGCCGGTGGGCCATGCTCGGTGCGCTCGGATGCGTCTTCCCCGAGCTTCTTGCACGCAATGGTGTCAAGTTCG
GTGAGGCCGTGTGGTTCAAGGCCGGCTCCCAAATTTTCAGCGAGGGCGGCCTCGACTACCTGGGCAACCCCAGCCTCGTGCATGCACAAAGCATCCTTGC
TATCTGGGCATGCCAAGTCGTGCTCATGGGTGCCGTTGAGGGGTACCGCGTTGCCGGCGGCCCACTTGGTGAGATTGTCGACCCACTCTACCCCGGCGGC
AGCTTCGACCCACTGGGCCTTGCCGACGATCCAGAGGCATTCGCGGAGCTCAAGGTGAAGGAAGTCAAGAACGGTCGCCTCGCCATGTTCTCTATGTTTG
GCTTCTTCGTGCAGGCCATCGTCACCGGCAAGGGCCCACTCGAGAACCTCACCGACCACCTCTCCGACCCTGTCAACAACAACGCATGGGCGTTTGCCAC
AAACTTTGTCCCCGGCAAGTGAGGCGTTGGCGCTCGCTAGCTGCGAGTTGTAGCCACAACTGCGGTGAACTGCACACATAATGTGTGGTTCAGATTGTAA
CATCATGGTGTAAATTACAA
page-top