Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig705
Contig Information
Length 684 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc16d08    rwhpc16d08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit lipid transfer protein precursor [Triticum aestivum] >gi|46252474|gb|AAS84745.1| lipid transfer protein [Triticum aestivum] >gi|55792862|gb|AAV65513.1| lipid transfer protein [Triticum aestivum]
Score 462
Evalue 1.973e-44
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig705
GGCTACTCGGTCGAGATGGCTCGCACTGCAGCAACAAAGCTCGTGCTGGTCGCCCTGGTGGCGGCAATGCTCCTGGTAGCCTCCGACGCGGCGATCTCCT
GCGGTCAGGTGAACTCTGCCCTGGCCTCCTGCGTCTCCTACGCAAAAGGCAGCGGGGCCAGCCCGCCTGGGGCCTGCTGTTCCGGAGTTAGGAGATTGGC
CGGCTTAGCGCGGAGCACCGCCGACAAGCAAGCGGCATGCAGGTGCATCAAGAGTGCTGCCGGTGGGCTCAACCCCGGAAAGGCTGCAAGTATCCCCTCC
AAGTGCGGCGTCAGCATCCCCTACTCCATCAGCGCATCCGTGGACTGCTCTAAGATCCACTGATCGATTACTTGCCGCCATCATCGCCGATTATAGCTCC
AGCGATAGATGCCGAGTACGTTGAGGTCACACACACACATATATATATATATATATATATACACATATACATGAATAAATGCTCTGATATGATCTCCATG
TGAGAGACAGGAGTACGTACGTCGAGCCAGCTCTGCATAGCCGGCCACTGTTGTATCTATTTTGTATCAGCGTTTGATTGTTCGTTCACTCCCTTTGAGC
AGAGACGGGAGTTTGTTGTACCTTTGTACCATGTGCACTCATGGTATTATAAATTAATCTANCTCTATTCAGTTAAAAAAAAAA
page-top