Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig678
Contig Information
Length 420 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10b15    rwhpc10b15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit possible membrane protein LEM1 [Hordeum vulgare]
Score 141
Evalue 1.35527e-07
Total Hit Count 7
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig678
AACACGTCCACCGGAGGGACCATGCCCATCTGCTACCTCGGATGCACCAACAACGCCGTCTTCTGCGCCACCGACTGCACCACCCAGGGGCTCTGATCCC
CAATCAATCCATCGATCAACCCATCCGGCCAGCGATGAACAATATATAGCCTCAATCTGTATGACATCATATATATGTATCAACGCATACGCACCGCATG
CATATATAATGCATTCACGCGCAATCAAGCATACTGCATAGACATTCCACCCCGGCCCGGCCCCTCTCAGGTATGAATGAATAATATCAGTTGTACTACT
ACGTTTCACTCGACCCGTTCCACTAGACGCACGCGAGCTTGTATGCTCAAGTGATGACTAGTGAATATACACAGCTTGCTATTATGTGCTTTACATAATG
ATTCTATCCCAAAAAAAAAA
page-top