Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig671
Contig Information
Length 1082 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc15o04    rwhpc15o04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Dehydrin COR410; AltName: Full=Cold-induced COR410 protein >gi|457389|gb|AAA20189.1| cold acclimation protein >gi|157153570|gb|ABV24865.1| dehydrin WZY1-2 [Triticum aestivum]
Score 620
Evalue 2.0925e-62
Total Hit Count 158
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig671
GAACCAATACTTGATCTGTTGTTTCCTTTAGCTCCCGGAAGACTTTTAGCTGCACCGATCGATCTCGATCATGGAGGATGAGAGGAGCACCCAGTCGTAC
CAGGGAGGTGAGGCCGCCGAGCAGGTGGAGGTGACGGACAGGGGCCTCCTCGGCAACCTCCTCGGCAAGAAGAAGGCTGAGGAGGACAAGGAGAAGGAGG
AGGAGCTGGTCACCGGCATGGAGAAGGTCTCCGTGGAAGAGCCCGAGGTCAAGAAGGAGGAGCACGAGGATGGCGAGAAGAAGGAGACCCTCTTCTCCAA
GCTGCACCGATCCAGCTCCAGCTCCAGCTCGTCTAGTGACGAGGAAGAAGAGGAGGTGATCGATGACAACGGCGAGGTGATCAAGAGGAAGAAGAAGAAG
GGGCTCAAGGAAAAGCTCCAGGGGAAGCTGCCCGGCCACAAGGACACCGAGGGTGAGCACGTGACGGGGCTACCGGCACCGGCGGCCCCCGCGTCTGTGC
AGACCCACGGCGGCCACCATGACACCGACGTCGTCGTCGAGAAGATCGACGGCGACGTGAAGACAGAGGCGGCACCGGCAGTGCCCGAGGAGGAGAAGAA
AGGCTTCTTGGAAAAGATCAAGGAGAAGCTGCCCGGCGGCCACAAGAAGCCGGAGGACGCTGCTGCGGTGCCCGTCACGCACGCTGCTCCAGCACCAGTG
CACGCGCCGGCGCCGGCCCCCGAGGAGGTGAGCAGCCCTGACGCGAAGGAGAAGAAGGGCCTGCTGGGCAAGATCATGGACAAGCTGCCTGGTTACCACA
AGACAGGGGAGGAGGACAAGGCCGCCGCCGCTACAGGCGAGCACAAGCCCAGCGCTTGATCGCCGCCGTGCCCGAGACCCGTGACCGGACCTCGATTGAA
TTGTTGGCGTGTGTTGTGTTTGCTTTACGTCTAAGTTGGTGTCAAGGTGGGAGGGGTTGATCGTCTTTGAAGGTCCGGTCCGTGAAGCCCGTTCAGTGAC
GGGTGCTTCTGTTTCAGTTTGGTTCAGAGTCAGGTCCTGGATGTTGTCAAGTTTGTTTACTTATGGGCACTTGTGTATTGGT
page-top